FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626572_at:

>probe:Drosophila_2:1626572_at:204:37; Interrogation_Position=109; Antisense; ATCATGAATCACTCGGGTGTGCCGG
>probe:Drosophila_2:1626572_at:670:597; Interrogation_Position=126; Antisense; TGTGCCGGTGAAAACCTCGATGGAT
>probe:Drosophila_2:1626572_at:49:649; Interrogation_Position=153; Antisense; TCAGGAGGGCTTGCAGTACGCCTGT
>probe:Drosophila_2:1626572_at:83:351; Interrogation_Position=165; Antisense; GCAGTACGCCTGTCTATATGACAAT
>probe:Drosophila_2:1626572_at:217:263; Interrogation_Position=205; Antisense; CAGGCGTTCCTCTCCAAAATGGAGC
>probe:Drosophila_2:1626572_at:494:351; Interrogation_Position=22; Antisense; GCAGAGACAGATCCAAAGCGAACTA
>probe:Drosophila_2:1626572_at:274:555; Interrogation_Position=225; Antisense; GGAGCCAGCCCAAAATTTGACTCTA
>probe:Drosophila_2:1626572_at:96:141; Interrogation_Position=249; Antisense; ACTGAGAGTTCGTACCAAGTATCAC
>probe:Drosophila_2:1626572_at:485:487; Interrogation_Position=260; Antisense; GTACCAAGTATCACGAGGTGCTCAT
>probe:Drosophila_2:1626572_at:203:509; Interrogation_Position=277; Antisense; GTGCTCATTACACCAGATGCCAAGA
>probe:Drosophila_2:1626572_at:314:265; Interrogation_Position=290; Antisense; CAGATGCCAAGATCACCGTTTTGGT
>probe:Drosophila_2:1626572_at:280:131; Interrogation_Position=304; Antisense; ACCGTTTTGGTGGTTCAGAATGCCA
>probe:Drosophila_2:1626572_at:374:355; Interrogation_Position=71; Antisense; GCAAAGTGCAGGAGAAACCCGGCGT
>probe:Drosophila_2:1626572_at:348:133; Interrogation_Position=87; Antisense; ACCCGGCGTGGAGGACATATTGATC

Paste this into a BLAST search page for me
ATCATGAATCACTCGGGTGTGCCGGTGTGCCGGTGAAAACCTCGATGGATTCAGGAGGGCTTGCAGTACGCCTGTGCAGTACGCCTGTCTATATGACAATCAGGCGTTCCTCTCCAAAATGGAGCGCAGAGACAGATCCAAAGCGAACTAGGAGCCAGCCCAAAATTTGACTCTAACTGAGAGTTCGTACCAAGTATCACGTACCAAGTATCACGAGGTGCTCATGTGCTCATTACACCAGATGCCAAGACAGATGCCAAGATCACCGTTTTGGTACCGTTTTGGTGGTTCAGAATGCCAGCAAAGTGCAGGAGAAACCCGGCGTACCCGGCGTGGAGGACATATTGATC

Full Affymetrix probeset data:

Annotations for 1626572_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720