Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626574_at:

>probe:Drosophila_2:1626574_at:281:257; Interrogation_Position=2469; Antisense; CAAATTCACTTGGTCTGGAGAGCAT
>probe:Drosophila_2:1626574_at:58:641; Interrogation_Position=2482; Antisense; TCTGGAGAGCATAGGCGGCGTATTT
>probe:Drosophila_2:1626574_at:186:351; Interrogation_Position=2537; Antisense; GCAGTTGTTGCGTTCTTCGAATTTT
>probe:Drosophila_2:1626574_at:521:339; Interrogation_Position=2588; Antisense; GCTACACCATCTCAATCAGTCGTTA
>probe:Drosophila_2:1626574_at:190:33; Interrogation_Position=2625; Antisense; ATCAAGATGGGATCCTCGAAAGCGA
>probe:Drosophila_2:1626574_at:632:321; Interrogation_Position=2646; Antisense; GCGAAAGAAACTATACCCCACCTGA
>probe:Drosophila_2:1626574_at:185:113; Interrogation_Position=2665; Antisense; ACCTGACCGTTCATTTTGGATCGAA
>probe:Drosophila_2:1626574_at:113:163; Interrogation_Position=2688; Antisense; AAATTGCTGAGGAACTCCGCTACGC
>probe:Drosophila_2:1626574_at:570:631; Interrogation_Position=2703; Antisense; TCCGCTACGCATCTTGGTGTATGAA
>probe:Drosophila_2:1626574_at:88:183; Interrogation_Position=2733; Antisense; AAAAGAGGCCTGCACTAACTCGCAC
>probe:Drosophila_2:1626574_at:658:355; Interrogation_Position=2744; Antisense; GCACTAACTCGCACATGTAGCAAAT
>probe:Drosophila_2:1626574_at:620:597; Interrogation_Position=2759; Antisense; TGTAGCAAATGTACCATCCCGAAAG
>probe:Drosophila_2:1626574_at:62:485; Interrogation_Position=2769; Antisense; GTACCATCCCGAAAGGCCAACGAAT
>probe:Drosophila_2:1626574_at:465:227; Interrogation_Position=2806; Antisense; AAGGCGTAATGCTTCTTAGTATTGA

Paste this into a BLAST search page for me
CAAATTCACTTGGTCTGGAGAGCATTCTGGAGAGCATAGGCGGCGTATTTGCAGTTGTTGCGTTCTTCGAATTTTGCTACACCATCTCAATCAGTCGTTAATCAAGATGGGATCCTCGAAAGCGAGCGAAAGAAACTATACCCCACCTGAACCTGACCGTTCATTTTGGATCGAAAAATTGCTGAGGAACTCCGCTACGCTCCGCTACGCATCTTGGTGTATGAAAAAAGAGGCCTGCACTAACTCGCACGCACTAACTCGCACATGTAGCAAATTGTAGCAAATGTACCATCCCGAAAGGTACCATCCCGAAAGGCCAACGAATAAGGCGTAATGCTTCTTAGTATTGA

Full Affymetrix probeset data:

Annotations for 1626574_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime