FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626575_at:

>probe:Drosophila_2:1626575_at:304:715; Interrogation_Position=5175; Antisense; TTCGGATCCGTGGTCAAGTTCATCA
>probe:Drosophila_2:1626575_at:92:415; Interrogation_Position=5201; Antisense; GACCATGGACTATCTAGACTAGCGA
>probe:Drosophila_2:1626575_at:681:481; Interrogation_Position=5250; Antisense; GTATCTGTAGATTTCTTTATCGCTT
>probe:Drosophila_2:1626575_at:717:697; Interrogation_Position=5265; Antisense; TTTATCGCTTTGTTGTAGGCATTAC
>probe:Drosophila_2:1626575_at:565:599; Interrogation_Position=5278; Antisense; TGTAGGCATTACACCAATCTCCCAT
>probe:Drosophila_2:1626575_at:276:643; Interrogation_Position=5310; Antisense; TCTCCTCCAGTCGATATTTTCCATA
>probe:Drosophila_2:1626575_at:9:485; Interrogation_Position=5350; Antisense; GTATGTCTGTGTCTGATATTTGTGT
>probe:Drosophila_2:1626575_at:66:569; Interrogation_Position=5414; Antisense; GGCAGATGTGCGAAGCGATCCAAGT
>probe:Drosophila_2:1626575_at:262:157; Interrogation_Position=5459; Antisense; ACACCAATCAGTGGGAGATGCCGAT
>probe:Drosophila_2:1626575_at:637:5; Interrogation_Position=5522; Antisense; ATTGAACGCTAGAAGGCCTCGCCTT
>probe:Drosophila_2:1626575_at:628:633; Interrogation_Position=5540; Antisense; TCGCCTTACGGATATCCACGATATA
>probe:Drosophila_2:1626575_at:573:687; Interrogation_Position=5653; Antisense; TATATGCATGTTTATCGGATCGGTC
>probe:Drosophila_2:1626575_at:724:449; Interrogation_Position=5670; Antisense; GATCGGTCTAGCCACTGTCATAAGT
>probe:Drosophila_2:1626575_at:378:715; Interrogation_Position=5699; Antisense; TTCGGAAACGAACTGCAACTTAATA

Paste this into a BLAST search page for me
TTCGGATCCGTGGTCAAGTTCATCAGACCATGGACTATCTAGACTAGCGAGTATCTGTAGATTTCTTTATCGCTTTTTATCGCTTTGTTGTAGGCATTACTGTAGGCATTACACCAATCTCCCATTCTCCTCCAGTCGATATTTTCCATAGTATGTCTGTGTCTGATATTTGTGTGGCAGATGTGCGAAGCGATCCAAGTACACCAATCAGTGGGAGATGCCGATATTGAACGCTAGAAGGCCTCGCCTTTCGCCTTACGGATATCCACGATATATATATGCATGTTTATCGGATCGGTCGATCGGTCTAGCCACTGTCATAAGTTTCGGAAACGAACTGCAACTTAATA

Full Affymetrix probeset data:

Annotations for 1626575_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720