FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626577_at:

>probe:Drosophila_2:1626577_at:30:49; Interrogation_Position=2159; Antisense; ATCCTCTGCTATCCTTCTGGATATG
>probe:Drosophila_2:1626577_at:64:711; Interrogation_Position=2186; Antisense; TTAAGTCTGGGCGTCATACTCCCTA
>probe:Drosophila_2:1626577_at:651:3; Interrogation_Position=2239; Antisense; ATTGGTGGGATACATCTCCTGGAGT
>probe:Drosophila_2:1626577_at:243:589; Interrogation_Position=2258; Antisense; TGGAGTGTCTATACAGCCCTGTTCA
>probe:Drosophila_2:1626577_at:581:123; Interrogation_Position=2272; Antisense; AGCCCTGTTCAAACGTGACCTTATC
>probe:Drosophila_2:1626577_at:495:511; Interrogation_Position=2286; Antisense; GTGACCTTATCTTCAAGCAACTCGG
>probe:Drosophila_2:1626577_at:585:193; Interrogation_Position=2304; Antisense; AACTCGGCCTGTTTGTGTTGCTCTT
>probe:Drosophila_2:1626577_at:243:469; Interrogation_Position=2320; Antisense; GTTGCTCTTCTTTCTTTTGGGAATA
>probe:Drosophila_2:1626577_at:664:457; Interrogation_Position=2375; Antisense; GATTTCGGAAGGATCTTCGCCTATT
>probe:Drosophila_2:1626577_at:277:719; Interrogation_Position=2390; Antisense; TTCGCCTATTTATTCTGCCTGACAG
>probe:Drosophila_2:1626577_at:497:303; Interrogation_Position=2478; Antisense; CCTGGTTGGGTCTCTGTTGCAATTC
>probe:Drosophila_2:1626577_at:16:687; Interrogation_Position=2527; Antisense; TATACAAATGCCCACTGACTCGATT
>probe:Drosophila_2:1626577_at:6:145; Interrogation_Position=2540; Antisense; ACTGACTCGATTTTGCAAGGCCTAA
>probe:Drosophila_2:1626577_at:699:227; Interrogation_Position=2556; Antisense; AAGGCCTAAGCCATTCATCAACAAA

Paste this into a BLAST search page for me
ATCCTCTGCTATCCTTCTGGATATGTTAAGTCTGGGCGTCATACTCCCTAATTGGTGGGATACATCTCCTGGAGTTGGAGTGTCTATACAGCCCTGTTCAAGCCCTGTTCAAACGTGACCTTATCGTGACCTTATCTTCAAGCAACTCGGAACTCGGCCTGTTTGTGTTGCTCTTGTTGCTCTTCTTTCTTTTGGGAATAGATTTCGGAAGGATCTTCGCCTATTTTCGCCTATTTATTCTGCCTGACAGCCTGGTTGGGTCTCTGTTGCAATTCTATACAAATGCCCACTGACTCGATTACTGACTCGATTTTGCAAGGCCTAAAAGGCCTAAGCCATTCATCAACAAA

Full Affymetrix probeset data:

Annotations for 1626577_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720