FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626578_at:

>probe:Drosophila_2:1626578_at:579:663; Interrogation_Position=4504; Antisense; TAAAGAGTCGTTCCTGGGTGACCAC
>probe:Drosophila_2:1626578_at:15:189; Interrogation_Position=4532; Antisense; AACACCTCAGAGTCCGAGTGATAAT
>probe:Drosophila_2:1626578_at:593:247; Interrogation_Position=4557; Antisense; CAAGTAACTCTAGCTGGTCCAACGA
>probe:Drosophila_2:1626578_at:6:547; Interrogation_Position=4626; Antisense; GGAGGACGGTCCACCATTACCAAGG
>probe:Drosophila_2:1626578_at:68:15; Interrogation_Position=4641; Antisense; ATTACCAAGGTCTACACGCCGTATC
>probe:Drosophila_2:1626578_at:538:665; Interrogation_Position=4653; Antisense; TACACGCCGTATCAGCAGCAAGTGG
>probe:Drosophila_2:1626578_at:97:651; Interrogation_Position=4679; Antisense; TCAGCCCACGGCAGAGGAGTATCAG
>probe:Drosophila_2:1626578_at:363:549; Interrogation_Position=4694; Antisense; GGAGTATCAGAGAACCACGCCCAGT
>probe:Drosophila_2:1626578_at:400:121; Interrogation_Position=4740; Antisense; AGCGAGCATCAACTCACGGCTAATG
>probe:Drosophila_2:1626578_at:523:381; Interrogation_Position=4779; Antisense; GAACTGGAGCTCCTTCAGGTTGATC
>probe:Drosophila_2:1626578_at:527:403; Interrogation_Position=4860; Antisense; GACTTCAACGGTGGAGCTGCTGTGC
>probe:Drosophila_2:1626578_at:7:157; Interrogation_Position=4890; Antisense; ACAGCCCACAAGGAGGTATTCTACG
>probe:Drosophila_2:1626578_at:454:687; Interrogation_Position=4906; Antisense; TATTCTACGACGGAGTAGCTGCCTC
>probe:Drosophila_2:1626578_at:254:551; Interrogation_Position=4955; Antisense; GGAGATTCTCTTTATCAGCTTGTTA

Paste this into a BLAST search page for me
TAAAGAGTCGTTCCTGGGTGACCACAACACCTCAGAGTCCGAGTGATAATCAAGTAACTCTAGCTGGTCCAACGAGGAGGACGGTCCACCATTACCAAGGATTACCAAGGTCTACACGCCGTATCTACACGCCGTATCAGCAGCAAGTGGTCAGCCCACGGCAGAGGAGTATCAGGGAGTATCAGAGAACCACGCCCAGTAGCGAGCATCAACTCACGGCTAATGGAACTGGAGCTCCTTCAGGTTGATCGACTTCAACGGTGGAGCTGCTGTGCACAGCCCACAAGGAGGTATTCTACGTATTCTACGACGGAGTAGCTGCCTCGGAGATTCTCTTTATCAGCTTGTTA

Full Affymetrix probeset data:

Annotations for 1626578_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720