FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626580_at:

>probe:Drosophila_2:1626580_at:236:321; Interrogation_Position=1746; Antisense; GCGCTTTTTCATTGATCTCCTGGAA
>probe:Drosophila_2:1626580_at:279:5; Interrogation_Position=1782; Antisense; ATTGAAGCCCGACAGCATTGTCTTC
>probe:Drosophila_2:1626580_at:414:5; Interrogation_Position=1798; Antisense; ATTGTCTTCCACAAGTTCCTGTTTC
>probe:Drosophila_2:1626580_at:227:503; Interrogation_Position=1839; Antisense; GTCGCTGCTCTTATTTCTCATAGAG
>probe:Drosophila_2:1626580_at:154:111; Interrogation_Position=1891; Antisense; AGCAATCAAGCGCAAACTCTCACGT
>probe:Drosophila_2:1626580_at:430:455; Interrogation_Position=1930; Antisense; GATACGGCTAACAGTGCCTTGGAAC
>probe:Drosophila_2:1626580_at:709:153; Interrogation_Position=1953; Antisense; ACAGGTGCTGGAACTTCTTAAGGAC
>probe:Drosophila_2:1626580_at:382:375; Interrogation_Position=2025; Antisense; GAAGAACCAGTTCAGCAAGGCCCTC
>probe:Drosophila_2:1626580_at:517:271; Interrogation_Position=2067; Antisense; CATTGTAATGACCTGCTTCCGTAGC
>probe:Drosophila_2:1626580_at:643:437; Interrogation_Position=2101; Antisense; GAGGAATCATTTCCCATGCCCGTAG
>probe:Drosophila_2:1626580_at:618:593; Interrogation_Position=2145; Antisense; TGTCGGTTCCATCCAAGAGTCGGCA
>probe:Drosophila_2:1626580_at:394:431; Interrogation_Position=2161; Antisense; GAGTCGGCAGCTGTATTTTAACATA
>probe:Drosophila_2:1626580_at:701:383; Interrogation_Position=2188; Antisense; GAACATGTATTTCTCACTTGCATCA
>probe:Drosophila_2:1626580_at:390:707; Interrogation_Position=2229; Antisense; TTACAAAACTAGGTACTCTGCCGGG

Paste this into a BLAST search page for me
GCGCTTTTTCATTGATCTCCTGGAAATTGAAGCCCGACAGCATTGTCTTCATTGTCTTCCACAAGTTCCTGTTTCGTCGCTGCTCTTATTTCTCATAGAGAGCAATCAAGCGCAAACTCTCACGTGATACGGCTAACAGTGCCTTGGAACACAGGTGCTGGAACTTCTTAAGGACGAAGAACCAGTTCAGCAAGGCCCTCCATTGTAATGACCTGCTTCCGTAGCGAGGAATCATTTCCCATGCCCGTAGTGTCGGTTCCATCCAAGAGTCGGCAGAGTCGGCAGCTGTATTTTAACATAGAACATGTATTTCTCACTTGCATCATTACAAAACTAGGTACTCTGCCGGG

Full Affymetrix probeset data:

Annotations for 1626580_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720