FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626583_at:

>probe:Drosophila_2:1626583_at:8:589; Interrogation_Position=1037; Antisense; TGGAGTTCCTCAAGCGACCGGTTAA
>probe:Drosophila_2:1626583_at:555:21; Interrogation_Position=1087; Antisense; ATAGGACTACCCATCTTTGTGAAGA
>probe:Drosophila_2:1626583_at:452:299; Interrogation_Position=1137; Antisense; CGCCCTGCTGCTAAAGATATCCAAG
>probe:Drosophila_2:1626583_at:417:573; Interrogation_Position=607; Antisense; GGCTGTTATTTCATGTTCCACATCG
>probe:Drosophila_2:1626583_at:44:305; Interrogation_Position=632; Antisense; CCTCGCTTTTCAGGCTTTTGGGAAT
>probe:Drosophila_2:1626583_at:659:193; Interrogation_Position=722; Antisense; AACTGCACACTAAAGTCCGCCGATT
>probe:Drosophila_2:1626583_at:426:475; Interrogation_Position=765; Antisense; GTTAGTTTCACCCTATGTTCTATCC
>probe:Drosophila_2:1626583_at:481:221; Interrogation_Position=791; Antisense; AAGTGGTCTTCAGTGCCTTCATCAT
>probe:Drosophila_2:1626583_at:658:681; Interrogation_Position=829; Antisense; TATCGACTGGTGCACATGGGCTTCA
>probe:Drosophila_2:1626583_at:229:65; Interrogation_Position=844; Antisense; ATGGGCTTCAAGCAGCGACCTGGAC
>probe:Drosophila_2:1626583_at:318:131; Interrogation_Position=880; Antisense; ACCGTGCAATTCGTGGCCGTCATGA
>probe:Drosophila_2:1626583_at:148:59; Interrogation_Position=901; Antisense; ATGATCGTCCAGATTTTCTTGCCCT
>probe:Drosophila_2:1626583_at:283:427; Interrogation_Position=940; Antisense; GAGTTGACCTTTCATGCCAATGCAC
>probe:Drosophila_2:1626583_at:632:643; Interrogation_Position=972; Antisense; TAGTGTCTTCGGTACCAATTGGCTG

Paste this into a BLAST search page for me
TGGAGTTCCTCAAGCGACCGGTTAAATAGGACTACCCATCTTTGTGAAGACGCCCTGCTGCTAAAGATATCCAAGGGCTGTTATTTCATGTTCCACATCGCCTCGCTTTTCAGGCTTTTGGGAATAACTGCACACTAAAGTCCGCCGATTGTTAGTTTCACCCTATGTTCTATCCAAGTGGTCTTCAGTGCCTTCATCATTATCGACTGGTGCACATGGGCTTCAATGGGCTTCAAGCAGCGACCTGGACACCGTGCAATTCGTGGCCGTCATGAATGATCGTCCAGATTTTCTTGCCCTGAGTTGACCTTTCATGCCAATGCACTAGTGTCTTCGGTACCAATTGGCTG

Full Affymetrix probeset data:

Annotations for 1626583_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720