FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626586_at:

>probe:Drosophila_2:1626586_at:144:563; Interrogation_Position=103; Antisense; GGAACCTATGACGATTTTATTGATT
>probe:Drosophila_2:1626586_at:95:473; Interrogation_Position=15; Antisense; GTTCAACACTAGACTTGCCATTTTT
>probe:Drosophila_2:1626586_at:646:421; Interrogation_Position=163; Antisense; GAGAAGTTTGACGATACCGACAATT
>probe:Drosophila_2:1626586_at:18:425; Interrogation_Position=319; Antisense; GAGACAGCGGTATCCATATCAAAGT
>probe:Drosophila_2:1626586_at:251:415; Interrogation_Position=349; Antisense; GAGAAGGCTCCCCAAGAAACCTGTG
>probe:Drosophila_2:1626586_at:145:701; Interrogation_Position=36; Antisense; TTTTTTGCTTCTTATCGTTGTTTCG
>probe:Drosophila_2:1626586_at:548:391; Interrogation_Position=364; Antisense; GAAACCTGTGCCTACGTCTATAAAT
>probe:Drosophila_2:1626586_at:100:509; Interrogation_Position=398; Antisense; GTGCATTCAAATCCGGACATTCAGT
>probe:Drosophila_2:1626586_at:373:557; Interrogation_Position=412; Antisense; GGACATTCAGTCATCAAGTTCGATT
>probe:Drosophila_2:1626586_at:235:561; Interrogation_Position=456; Antisense; GGAAACCGCTGGACTAATAGCTGAA
>probe:Drosophila_2:1626586_at:287:269; Interrogation_Position=484; Antisense; CAGGCGGATCTGTTTGATTACGATA
>probe:Drosophila_2:1626586_at:2:639; Interrogation_Position=50; Antisense; TCGTTGTTTCGCTTAGCCAAGCTAA
>probe:Drosophila_2:1626586_at:606:337; Interrogation_Position=70; Antisense; GCTAAGGAAAGCCAACCCTTTGACT
>probe:Drosophila_2:1626586_at:695:519; Interrogation_Position=88; Antisense; TTTGACTTTTTCGAAGGAACCTATG

Paste this into a BLAST search page for me
GGAACCTATGACGATTTTATTGATTGTTCAACACTAGACTTGCCATTTTTGAGAAGTTTGACGATACCGACAATTGAGACAGCGGTATCCATATCAAAGTGAGAAGGCTCCCCAAGAAACCTGTGTTTTTTGCTTCTTATCGTTGTTTCGGAAACCTGTGCCTACGTCTATAAATGTGCATTCAAATCCGGACATTCAGTGGACATTCAGTCATCAAGTTCGATTGGAAACCGCTGGACTAATAGCTGAACAGGCGGATCTGTTTGATTACGATATCGTTGTTTCGCTTAGCCAAGCTAAGCTAAGGAAAGCCAACCCTTTGACTTTTGACTTTTTCGAAGGAACCTATG

Full Affymetrix probeset data:

Annotations for 1626586_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720