Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626588_a_at:

>probe:Drosophila_2:1626588_a_at:466:175; Interrogation_Position=136; Antisense; AAACGACTTGCTGGACAGTGCTCTC
>probe:Drosophila_2:1626588_a_at:722:399; Interrogation_Position=149; Antisense; GACAGTGCTCTCCAGGATTTCGATA
>probe:Drosophila_2:1626588_a_at:86:185; Interrogation_Position=192; Antisense; AAAAGGAGCCGTCCGCATCATCGGA
>probe:Drosophila_2:1626588_a_at:367:37; Interrogation_Position=208; Antisense; ATCATCGGATGTGGCGACCAACGCT
>probe:Drosophila_2:1626588_a_at:721:281; Interrogation_Position=237; Antisense; CTGAGGGCTCCGAGGATCCAGATGC
>probe:Drosophila_2:1626588_a_at:395:445; Interrogation_Position=257; Antisense; GATGCGTTTTTCATTGAGCAGGCCA
>probe:Drosophila_2:1626588_a_at:242:223; Interrogation_Position=281; Antisense; AAGGTGCTGGCCGATCGCATGAACA
>probe:Drosophila_2:1626588_a_at:408:613; Interrogation_Position=300; Antisense; TGAACACGCTCTTCGGAGGTCCGGA
>probe:Drosophila_2:1626588_a_at:229:295; Interrogation_Position=364; Antisense; CGACCAGATCATGGCCGGTTTCAAA
>probe:Drosophila_2:1626588_a_at:693:435; Interrogation_Position=443; Antisense; GAGGATGTCTCCAAGTATTCTGATA
>probe:Drosophila_2:1626588_a_at:686:25; Interrogation_Position=465; Antisense; ATAGCATTTCCCAGGCTCTCAAGGG
>probe:Drosophila_2:1626588_a_at:221:215; Interrogation_Position=495; Antisense; AAGAGGGCTCCGAGAACCTGGCTGC
>probe:Drosophila_2:1626588_a_at:70:191; Interrogation_Position=659; Antisense; AACATGTTCCTACCATTCATGGAGG
>probe:Drosophila_2:1626588_a_at:71:641; Interrogation_Position=704; Antisense; TCGGCGGAGATTCTGTTGCCCAGCA

Paste this into a BLAST search page for me
AAACGACTTGCTGGACAGTGCTCTCGACAGTGCTCTCCAGGATTTCGATAAAAAGGAGCCGTCCGCATCATCGGAATCATCGGATGTGGCGACCAACGCTCTGAGGGCTCCGAGGATCCAGATGCGATGCGTTTTTCATTGAGCAGGCCAAAGGTGCTGGCCGATCGCATGAACATGAACACGCTCTTCGGAGGTCCGGACGACCAGATCATGGCCGGTTTCAAAGAGGATGTCTCCAAGTATTCTGATAATAGCATTTCCCAGGCTCTCAAGGGAAGAGGGCTCCGAGAACCTGGCTGCAACATGTTCCTACCATTCATGGAGGTCGGCGGAGATTCTGTTGCCCAGCA

Full Affymetrix probeset data:

Annotations for 1626588_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime