FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626591_at:

>probe:Drosophila_2:1626591_at:235:305; Interrogation_Position=4537; Antisense; CCTTCGTTCTCTGCTAATATTAATG
>probe:Drosophila_2:1626591_at:634:499; Interrogation_Position=4580; Antisense; GTCTGTTTTACACTATCTACACACT
>probe:Drosophila_2:1626591_at:137:347; Interrogation_Position=4640; Antisense; GCATACTATAATACACCCACAATCT
>probe:Drosophila_2:1626591_at:718:3; Interrogation_Position=4698; Antisense; ATTGTATAACTCTAATCCTCTCCAG
>probe:Drosophila_2:1626591_at:31:657; Interrogation_Position=4710; Antisense; TAATCCTCTCCAGACACTTGAAACA
>probe:Drosophila_2:1626591_at:113:613; Interrogation_Position=4728; Antisense; TGAAACACCAATTTACCCCTGGGCA
>probe:Drosophila_2:1626591_at:678:643; Interrogation_Position=4757; Antisense; TCTATGCCCATACCCGTTTTGATCT
>probe:Drosophila_2:1626591_at:309:623; Interrogation_Position=4787; Antisense; TCCCCTTACGAATTACAAAAGCGAT
>probe:Drosophila_2:1626591_at:129:203; Interrogation_Position=4805; Antisense; AAGCGATTGGCGAAAGTAGTTTCAT
>probe:Drosophila_2:1626591_at:706:687; Interrogation_Position=4847; Antisense; TATATCCCGATAAGTGCGCGCTATG
>probe:Drosophila_2:1626591_at:11:221; Interrogation_Position=4858; Antisense; AAGTGCGCGCTATGTATATTATATA
>probe:Drosophila_2:1626591_at:87:715; Interrogation_Position=4885; Antisense; TTGTTTACCCTACATTTTCTCTGTG
>probe:Drosophila_2:1626591_at:188:217; Interrogation_Position=4923; Antisense; AAGTTCGTGTATACCGCGTGTGTGT
>probe:Drosophila_2:1626591_at:643:595; Interrogation_Position=4941; Antisense; TGTGTGTGTATATACCCTGAATATT

Paste this into a BLAST search page for me
CCTTCGTTCTCTGCTAATATTAATGGTCTGTTTTACACTATCTACACACTGCATACTATAATACACCCACAATCTATTGTATAACTCTAATCCTCTCCAGTAATCCTCTCCAGACACTTGAAACATGAAACACCAATTTACCCCTGGGCATCTATGCCCATACCCGTTTTGATCTTCCCCTTACGAATTACAAAAGCGATAAGCGATTGGCGAAAGTAGTTTCATTATATCCCGATAAGTGCGCGCTATGAAGTGCGCGCTATGTATATTATATATTGTTTACCCTACATTTTCTCTGTGAAGTTCGTGTATACCGCGTGTGTGTTGTGTGTGTATATACCCTGAATATT

Full Affymetrix probeset data:

Annotations for 1626591_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720