FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626593_at:

>probe:Drosophila_2:1626593_at:38:21; Interrogation_Position=399; Antisense; ATATGATCTTTTGCCGGCGTCGGAA
>probe:Drosophila_2:1626593_at:698:649; Interrogation_Position=460; Antisense; TCAACATTTTCCTCGCAAAGTACCA
>probe:Drosophila_2:1626593_at:455:251; Interrogation_Position=524; Antisense; CAAGTACGAGTTCCAGTTCCACGGG
>probe:Drosophila_2:1626593_at:565:105; Interrogation_Position=578; Antisense; AGACACCCACATTTGAAAGCCATTT
>probe:Drosophila_2:1626593_at:97:19; Interrogation_Position=624; Antisense; ATTTGGAGGCATTTTCGGCTTGGGC
>probe:Drosophila_2:1626593_at:61:553; Interrogation_Position=680; Antisense; GGAGCACGGTTCAATGCCTGATACT
>probe:Drosophila_2:1626593_at:545:455; Interrogation_Position=699; Antisense; GATACTTCCCAGATTTTTCCTGCTG
>probe:Drosophila_2:1626593_at:494:361; Interrogation_Position=743; Antisense; GCAATGTTTGGGAGCGCAGACTGTT
>probe:Drosophila_2:1626593_at:724:677; Interrogation_Position=769; Antisense; TATGTGGGCGTCATGGTTCCATCCA
>probe:Drosophila_2:1626593_at:15:697; Interrogation_Position=804; Antisense; TTTTGCCCACTATCGTAAAGCTTGC
>probe:Drosophila_2:1626593_at:572:409; Interrogation_Position=850; Antisense; GACCTAATTTCCGAGACCTTGAAGC
>probe:Drosophila_2:1626593_at:388:307; Interrogation_Position=866; Antisense; CCTTGAAGCCCTCCGATAATGACAT
>probe:Drosophila_2:1626593_at:665:609; Interrogation_Position=885; Antisense; TGACATCACACACATCGAAGACGTT
>probe:Drosophila_2:1626593_at:342:375; Interrogation_Position=901; Antisense; GAAGACGTTCCCATAATTTGCAGAA

Paste this into a BLAST search page for me
ATATGATCTTTTGCCGGCGTCGGAATCAACATTTTCCTCGCAAAGTACCACAAGTACGAGTTCCAGTTCCACGGGAGACACCCACATTTGAAAGCCATTTATTTGGAGGCATTTTCGGCTTGGGCGGAGCACGGTTCAATGCCTGATACTGATACTTCCCAGATTTTTCCTGCTGGCAATGTTTGGGAGCGCAGACTGTTTATGTGGGCGTCATGGTTCCATCCATTTTGCCCACTATCGTAAAGCTTGCGACCTAATTTCCGAGACCTTGAAGCCCTTGAAGCCCTCCGATAATGACATTGACATCACACACATCGAAGACGTTGAAGACGTTCCCATAATTTGCAGAA

Full Affymetrix probeset data:

Annotations for 1626593_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720