Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626594_s_at:

>probe:Drosophila_2:1626594_s_at:385:159; Interrogation_Position=103; Antisense; ACAACGGTAACAACGGCAGCGGCGG
>probe:Drosophila_2:1626594_s_at:147:121; Interrogation_Position=120; Antisense; AGCGGCGGCAGCATTTGCAATCAGC
>probe:Drosophila_2:1626594_s_at:188:35; Interrogation_Position=139; Antisense; ATCAGCAGATCAACAACTACGGCAA
>probe:Drosophila_2:1626594_s_at:165:501; Interrogation_Position=180; Antisense; GTCGGCAATCATATGAGTGCAGGCA
>probe:Drosophila_2:1626594_s_at:448:347; Interrogation_Position=198; Antisense; GCAGGCAGTTTTTTCGGTGGGTCCA
>probe:Drosophila_2:1626594_s_at:221:505; Interrogation_Position=218; Antisense; GTCCAACAACAGCATCCACAGTAGT
>probe:Drosophila_2:1626594_s_at:436:485; Interrogation_Position=238; Antisense; GTAGTGGCAATAGCAATACCGATTA
>probe:Drosophila_2:1626594_s_at:466:27; Interrogation_Position=253; Antisense; ATACCGATTATATGACCACGCCAGC
>probe:Drosophila_2:1626594_s_at:667:533; Interrogation_Position=317; Antisense; GGTGAACACCACAACGATGCTGTCT
>probe:Drosophila_2:1626594_s_at:143:623; Interrogation_Position=334; Antisense; TGCTGTCTAATTACTGCGATGCCGC
>probe:Drosophila_2:1626594_s_at:5:583; Interrogation_Position=370; Antisense; TGGCCGCTGCTGCAGTCAATGCAAA
>probe:Drosophila_2:1626594_s_at:39:129; Interrogation_Position=415; Antisense; ACCAGCGCATGTTGCTCGCGGGCAG
>probe:Drosophila_2:1626594_s_at:549:457; Interrogation_Position=642; Antisense; GATATCAGCGAAGTTCCTCTCATTG
>probe:Drosophila_2:1626594_s_at:697:121; Interrogation_Position=93; Antisense; AGCGGTTGCCACAACGGTAACAACG

Paste this into a BLAST search page for me
ACAACGGTAACAACGGCAGCGGCGGAGCGGCGGCAGCATTTGCAATCAGCATCAGCAGATCAACAACTACGGCAAGTCGGCAATCATATGAGTGCAGGCAGCAGGCAGTTTTTTCGGTGGGTCCAGTCCAACAACAGCATCCACAGTAGTGTAGTGGCAATAGCAATACCGATTAATACCGATTATATGACCACGCCAGCGGTGAACACCACAACGATGCTGTCTTGCTGTCTAATTACTGCGATGCCGCTGGCCGCTGCTGCAGTCAATGCAAAACCAGCGCATGTTGCTCGCGGGCAGGATATCAGCGAAGTTCCTCTCATTGAGCGGTTGCCACAACGGTAACAACG

Full Affymetrix probeset data:

Annotations for 1626594_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime