FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626596_at:

>probe:Drosophila_2:1626596_at:409:647; Interrogation_Position=1621; Antisense; TCATCGATCTTTGACCATGGAGCAT
>probe:Drosophila_2:1626596_at:94:553; Interrogation_Position=1639; Antisense; GGAGCATATTAAGCCGGCGCATACC
>probe:Drosophila_2:1626596_at:232:213; Interrogation_Position=1664; Antisense; AAGACCTTCTTCTTGGACACCAACA
>probe:Drosophila_2:1626596_at:417:215; Interrogation_Position=1739; Antisense; AAGATTATCGACAGCCAGGCCGAGG
>probe:Drosophila_2:1626596_at:542:391; Interrogation_Position=1768; Antisense; GAAAGATCTGTTGCCCATACTGCTG
>probe:Drosophila_2:1626596_at:503:29; Interrogation_Position=1784; Antisense; ATACTGCTGATGAGTGGCCGTACCC
>probe:Drosophila_2:1626596_at:108:489; Interrogation_Position=1803; Antisense; GTACCCACTGGTCGAATTCTTTCGG
>probe:Drosophila_2:1626596_at:233:101; Interrogation_Position=1885; Antisense; AGAGTTCCTTGTTATGTGGCTGACA
>probe:Drosophila_2:1626596_at:520:611; Interrogation_Position=1905; Antisense; TGACAGGAGTTGTTCCCCGTGATAT
>probe:Drosophila_2:1626596_at:503:591; Interrogation_Position=1929; Antisense; TGAAACTACTGGCTACCTTTTCGGT
>probe:Drosophila_2:1626596_at:296:265; Interrogation_Position=1973; Antisense; CAGATGGCCGATTGCGTTGGCGTTA
>probe:Drosophila_2:1626596_at:251:467; Interrogation_Position=1988; Antisense; GTTGGCGTTAGCACTGGTTATATCT
>probe:Drosophila_2:1626596_at:481:57; Interrogation_Position=2066; Antisense; ATGATCCTGCCCATGAGCATGATCT
>probe:Drosophila_2:1626596_at:21:463; Interrogation_Position=2115; Antisense; GATTACTGCCCATTCAGGTGAAGGT

Paste this into a BLAST search page for me
TCATCGATCTTTGACCATGGAGCATGGAGCATATTAAGCCGGCGCATACCAAGACCTTCTTCTTGGACACCAACAAAGATTATCGACAGCCAGGCCGAGGGAAAGATCTGTTGCCCATACTGCTGATACTGCTGATGAGTGGCCGTACCCGTACCCACTGGTCGAATTCTTTCGGAGAGTTCCTTGTTATGTGGCTGACATGACAGGAGTTGTTCCCCGTGATATTGAAACTACTGGCTACCTTTTCGGTCAGATGGCCGATTGCGTTGGCGTTAGTTGGCGTTAGCACTGGTTATATCTATGATCCTGCCCATGAGCATGATCTGATTACTGCCCATTCAGGTGAAGGT

Full Affymetrix probeset data:

Annotations for 1626596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720