Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626597_at:

>probe:Drosophila_2:1626597_at:147:37; Interrogation_Position=1300; Antisense; ATCTCACGTGCCTTTGGTTTGAAGA
>probe:Drosophila_2:1626597_at:486:505; Interrogation_Position=1326; Antisense; GTCCATATACGATACACTCTTTGCC
>probe:Drosophila_2:1626597_at:244:613; Interrogation_Position=1370; Antisense; TGAATGCCTTCATGATCTTCCCCAT
>probe:Drosophila_2:1626597_at:25:721; Interrogation_Position=1387; Antisense; TTCCCCATGATTTTGCGCCCAAAGA
>probe:Drosophila_2:1626597_at:612:213; Interrogation_Position=1432; Antisense; AAGAGCAGTGATCCCTTCAAGTATC
>probe:Drosophila_2:1626597_at:165:607; Interrogation_Position=1460; Antisense; TGATCCATGCCAATTACTTTGCCCA
>probe:Drosophila_2:1626597_at:706:721; Interrogation_Position=1478; Antisense; TTGCCCATCCCTACGATGTTGATAT
>probe:Drosophila_2:1626597_at:597:529; Interrogation_Position=1512; Antisense; GGGTCTACTTAAGGCCATTAGTCTG
>probe:Drosophila_2:1626597_at:323:615; Interrogation_Position=1636; Antisense; TGCTATGTGAGGCACTTTACCTTCA
>probe:Drosophila_2:1626597_at:645:639; Interrogation_Position=1658; Antisense; TCACCATTTACCATTATTCCGGCAC
>probe:Drosophila_2:1626597_at:554:99; Interrogation_Position=1688; Antisense; AGATGGGTCCCAAATCCGATCGAGC
>probe:Drosophila_2:1626597_at:123:451; Interrogation_Position=1705; Antisense; GATCGAGCTGCAGTTGTGGACCATC
>probe:Drosophila_2:1626597_at:623:623; Interrogation_Position=1757; Antisense; TGCGAGTCGCAGATGCCAGCATTAT
>probe:Drosophila_2:1626597_at:704:411; Interrogation_Position=1811; Antisense; GACCCGTCTTCATGATTGCCGAGAA

Paste this into a BLAST search page for me
ATCTCACGTGCCTTTGGTTTGAAGAGTCCATATACGATACACTCTTTGCCTGAATGCCTTCATGATCTTCCCCATTTCCCCATGATTTTGCGCCCAAAGAAAGAGCAGTGATCCCTTCAAGTATCTGATCCATGCCAATTACTTTGCCCATTGCCCATCCCTACGATGTTGATATGGGTCTACTTAAGGCCATTAGTCTGTGCTATGTGAGGCACTTTACCTTCATCACCATTTACCATTATTCCGGCACAGATGGGTCCCAAATCCGATCGAGCGATCGAGCTGCAGTTGTGGACCATCTGCGAGTCGCAGATGCCAGCATTATGACCCGTCTTCATGATTGCCGAGAA

Full Affymetrix probeset data:

Annotations for 1626597_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime