FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626600_at:

>probe:Drosophila_2:1626600_at:150:711; Interrogation_Position=107; Antisense; TTCAGGAATGGAGATCCCTTCGGGC
>probe:Drosophila_2:1626600_at:120:715; Interrogation_Position=125; Antisense; TTCGGGCGGCCCAAACTGATGCGGA
>probe:Drosophila_2:1626600_at:375:177; Interrogation_Position=137; Antisense; AAACTGATGCGGATGGTCGCTGCCT
>probe:Drosophila_2:1626600_at:362:627; Interrogation_Position=157; Antisense; TGCCTGCTCTTGGAACCTGGTCAAT
>probe:Drosophila_2:1626600_at:387:583; Interrogation_Position=167; Antisense; TGGAACCTGGTCAATTTCCCGGCGG
>probe:Drosophila_2:1626600_at:262:717; Interrogation_Position=182; Antisense; TTCCCGGCGGGATCTATAAGCTGAC
>probe:Drosophila_2:1626600_at:28:33; Interrogation_Position=197; Antisense; ATAAGCTGACCTTTCACGTGGGCGC
>probe:Drosophila_2:1626600_at:22:135; Interrogation_Position=227; Antisense; ACGCGGAGCGCAATGTGAGGACACT
>probe:Drosophila_2:1626600_at:597:393; Interrogation_Position=23; Antisense; GAAAGTTTTCTACCCACATATTGGA
>probe:Drosophila_2:1626600_at:430:397; Interrogation_Position=246; Antisense; GACACTTTATCCAGCAATTGACTTG
>probe:Drosophila_2:1626600_at:258:7; Interrogation_Position=304; Antisense; ATTCCTTTGTTACTCAATCCCTTTG
>probe:Drosophila_2:1626600_at:539:235; Interrogation_Position=319; Antisense; AATCCCTTTGGGTATTCCACATATC
>probe:Drosophila_2:1626600_at:318:151; Interrogation_Position=38; Antisense; ACATATTGGATACTTCGGTGGGAAA
>probe:Drosophila_2:1626600_at:539:421; Interrogation_Position=78; Antisense; GAGAGTAACAGTTTCCAGGCTGGAC

Paste this into a BLAST search page for me
TTCAGGAATGGAGATCCCTTCGGGCTTCGGGCGGCCCAAACTGATGCGGAAAACTGATGCGGATGGTCGCTGCCTTGCCTGCTCTTGGAACCTGGTCAATTGGAACCTGGTCAATTTCCCGGCGGTTCCCGGCGGGATCTATAAGCTGACATAAGCTGACCTTTCACGTGGGCGCACGCGGAGCGCAATGTGAGGACACTGAAAGTTTTCTACCCACATATTGGAGACACTTTATCCAGCAATTGACTTGATTCCTTTGTTACTCAATCCCTTTGAATCCCTTTGGGTATTCCACATATCACATATTGGATACTTCGGTGGGAAAGAGAGTAACAGTTTCCAGGCTGGAC

Full Affymetrix probeset data:

Annotations for 1626600_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720