FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626601_at:

>probe:Drosophila_2:1626601_at:115:629; Interrogation_Position=104; Antisense; TCCGAGTTCCTGGAGTTCTACGGTC
>probe:Drosophila_2:1626601_at:309:511; Interrogation_Position=155; Antisense; GTGAACATCGACAAGCCCGGCATTC
>probe:Drosophila_2:1626601_at:693:123; Interrogation_Position=168; Antisense; AGCCCGGCATTCTGGATCTCAAGAA
>probe:Drosophila_2:1626601_at:629:481; Interrogation_Position=19; Antisense; GTATCTTTTACAAACTTATGACAAA
>probe:Drosophila_2:1626601_at:225:59; Interrogation_Position=200; Antisense; ATGTACGAGGCCTGGAACGCCCACA
>probe:Drosophila_2:1626601_at:324:251; Interrogation_Position=286; Antisense; CAAGTACGCCTAAGGCCAGACTATT
>probe:Drosophila_2:1626601_at:513:657; Interrogation_Position=296; Antisense; TAAGGCCAGACTATTCTCCAGACTG
>probe:Drosophila_2:1626601_at:708:103; Interrogation_Position=303; Antisense; AGACTATTCTCCAGACTGTTCTCTA
>probe:Drosophila_2:1626601_at:154:283; Interrogation_Position=311; Antisense; CTCCAGACTGTTCTCTATCTGACAA
>probe:Drosophila_2:1626601_at:563:469; Interrogation_Position=320; Antisense; GTTCTCTATCTGACAAATAAACTCG
>probe:Drosophila_2:1626601_at:4:497; Interrogation_Position=47; Antisense; GTCAGTTTTGAGGAAGCCGCCGAAC
>probe:Drosophila_2:1626601_at:708:437; Interrogation_Position=56; Antisense; GAGGAAGCCGCCGAACTCGCCAAGA
>probe:Drosophila_2:1626601_at:595:383; Interrogation_Position=68; Antisense; GAACTCGCCAAGAACTTCTCCAAGA
>probe:Drosophila_2:1626601_at:610:107; Interrogation_Position=78; Antisense; AGAACTTCTCCAAGAAGCCCACCGA

Paste this into a BLAST search page for me
TCCGAGTTCCTGGAGTTCTACGGTCGTGAACATCGACAAGCCCGGCATTCAGCCCGGCATTCTGGATCTCAAGAAGTATCTTTTACAAACTTATGACAAAATGTACGAGGCCTGGAACGCCCACACAAGTACGCCTAAGGCCAGACTATTTAAGGCCAGACTATTCTCCAGACTGAGACTATTCTCCAGACTGTTCTCTACTCCAGACTGTTCTCTATCTGACAAGTTCTCTATCTGACAAATAAACTCGGTCAGTTTTGAGGAAGCCGCCGAACGAGGAAGCCGCCGAACTCGCCAAGAGAACTCGCCAAGAACTTCTCCAAGAAGAACTTCTCCAAGAAGCCCACCGA

Full Affymetrix probeset data:

Annotations for 1626601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720