FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626602_at:

>probe:Drosophila_2:1626602_at:21:279; Interrogation_Position=1036; Antisense; CTGTTTCGGCTCACTAAGCTACTGA
>probe:Drosophila_2:1626602_at:344:117; Interrogation_Position=1052; Antisense; AGCTACTGACCTTTGTAACGGGCGT
>probe:Drosophila_2:1626602_at:568:35; Interrogation_Position=588; Antisense; ATCATCGTGTCCTGCGGCTGGGATC
>probe:Drosophila_2:1626602_at:671:529; Interrogation_Position=607; Antisense; GGGATCGCACCGTCAAGGTCTGGAA
>probe:Drosophila_2:1626602_at:469:79; Interrogation_Position=622; Antisense; AGGTCTGGAACTTGGCTAACTGCAA
>probe:Drosophila_2:1626602_at:414:159; Interrogation_Position=670; Antisense; ACAACGGCTACCTGAACACGGTGAC
>probe:Drosophila_2:1626602_at:172:533; Interrogation_Position=726; Antisense; GGTGGCAAGGACTCCAAGGCCCTGC
>probe:Drosophila_2:1626602_at:110:623; Interrogation_Position=748; Antisense; TGCTGTGGGACCTCAATGACGGCAA
>probe:Drosophila_2:1626602_at:618:407; Interrogation_Position=765; Antisense; GACGGCAAGAACCTGTACACTCTGG
>probe:Drosophila_2:1626602_at:700:145; Interrogation_Position=783; Antisense; ACTCTGGAGCACAACGACATCATCA
>probe:Drosophila_2:1626602_at:503:669; Interrogation_Position=834; Antisense; TACTGGCTGTGCGTGGCCTACGGAC
>probe:Drosophila_2:1626602_at:442:669; Interrogation_Position=852; Antisense; TACGGACCCTCGATCAAGATCTGGG
>probe:Drosophila_2:1626602_at:526:97; Interrogation_Position=868; Antisense; AGATCTGGGATCTGGCATGCAAGAA
>probe:Drosophila_2:1626602_at:412:109; Interrogation_Position=889; Antisense; AGAAGACCGTTGAGGAGCTGCGCCC

Paste this into a BLAST search page for me
CTGTTTCGGCTCACTAAGCTACTGAAGCTACTGACCTTTGTAACGGGCGTATCATCGTGTCCTGCGGCTGGGATCGGGATCGCACCGTCAAGGTCTGGAAAGGTCTGGAACTTGGCTAACTGCAAACAACGGCTACCTGAACACGGTGACGGTGGCAAGGACTCCAAGGCCCTGCTGCTGTGGGACCTCAATGACGGCAAGACGGCAAGAACCTGTACACTCTGGACTCTGGAGCACAACGACATCATCATACTGGCTGTGCGTGGCCTACGGACTACGGACCCTCGATCAAGATCTGGGAGATCTGGGATCTGGCATGCAAGAAAGAAGACCGTTGAGGAGCTGCGCCC

Full Affymetrix probeset data:

Annotations for 1626602_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720