FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626603_at:

>probe:Drosophila_2:1626603_at:690:191; Interrogation_Position=110; Antisense; AACTTCAGACGCAGCAATCCCAGCA
>probe:Drosophila_2:1626603_at:724:63; Interrogation_Position=13; Antisense; ATGGAACGCCGCCAAGCCCTAGACT
>probe:Drosophila_2:1626603_at:470:111; Interrogation_Position=131; Antisense; AGCAATCTCAGCAGTCCCAGCTAGA
>probe:Drosophila_2:1626603_at:336:309; Interrogation_Position=147; Antisense; CCAGCTAGACGCCTTCAATTATTCA
>probe:Drosophila_2:1626603_at:618:411; Interrogation_Position=154; Antisense; GACGCCTTCAATTATTCAGCAACAA
>probe:Drosophila_2:1626603_at:324:711; Interrogation_Position=168; Antisense; TTCAGCAACAATGTCATCATCGTCG
>probe:Drosophila_2:1626603_at:35:219; Interrogation_Position=201; Antisense; AAGTCAGGCCATGTCCACAGCCATG
>probe:Drosophila_2:1626603_at:275:609; Interrogation_Position=287; Antisense; TGAGAGCCACCACCATTGGCACCGT
>probe:Drosophila_2:1626603_at:123:3; Interrogation_Position=301; Antisense; ATTGGCACCGTTGTCGTCCGATGCG
>probe:Drosophila_2:1626603_at:519:675; Interrogation_Position=32; Antisense; TAGACTCATCGATGTCTTCGCTCTA
>probe:Drosophila_2:1626603_at:666:51; Interrogation_Position=321; Antisense; ATGCGGACCCATCCAGCTGGTGATA
>probe:Drosophila_2:1626603_at:214:287; Interrogation_Position=337; Antisense; CTGGTGATAGCGCTCCTACAAGTGA
>probe:Drosophila_2:1626603_at:240:219; Interrogation_Position=356; Antisense; AAGTGAGTTGTACTCTTGTACCCCG
>probe:Drosophila_2:1626603_at:700:599; Interrogation_Position=364; Antisense; TGTACTCTTGTACCCCGCAAACAAT

Paste this into a BLAST search page for me
AACTTCAGACGCAGCAATCCCAGCAATGGAACGCCGCCAAGCCCTAGACTAGCAATCTCAGCAGTCCCAGCTAGACCAGCTAGACGCCTTCAATTATTCAGACGCCTTCAATTATTCAGCAACAATTCAGCAACAATGTCATCATCGTCGAAGTCAGGCCATGTCCACAGCCATGTGAGAGCCACCACCATTGGCACCGTATTGGCACCGTTGTCGTCCGATGCGTAGACTCATCGATGTCTTCGCTCTAATGCGGACCCATCCAGCTGGTGATACTGGTGATAGCGCTCCTACAAGTGAAAGTGAGTTGTACTCTTGTACCCCGTGTACTCTTGTACCCCGCAAACAAT

Full Affymetrix probeset data:

Annotations for 1626603_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720