FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626604_at:

>probe:Drosophila_2:1626604_at:448:5; Interrogation_Position=451; Antisense; ATTGCTGTCCCGATCAGGAGGTATA
>probe:Drosophila_2:1626604_at:290:483; Interrogation_Position=471; Antisense; GTATATCAGCCCATGAATCGCCGCA
>probe:Drosophila_2:1626604_at:677:379; Interrogation_Position=510; Antisense; GAACCACCACTTTCGGCTATTGAAA
>probe:Drosophila_2:1626604_at:24:389; Interrogation_Position=531; Antisense; GAAAAGCACCTCTTCCAGATGAGTA
>probe:Drosophila_2:1626604_at:393:483; Interrogation_Position=553; Antisense; GTATCTTTTGCAAGTCCGTCAGGGC
>probe:Drosophila_2:1626604_at:270:595; Interrogation_Position=585; Antisense; TGTAAAGTAGGTCGACGTCCGCCCA
>probe:Drosophila_2:1626604_at:37:549; Interrogation_Position=625; Antisense; GGAGGCCATCCGAATGCTGCAAGAA
>probe:Drosophila_2:1626604_at:90:375; Interrogation_Position=647; Antisense; GAAGTTCACTCCGATGCCTAGTTTT
>probe:Drosophila_2:1626604_at:43:457; Interrogation_Position=692; Antisense; GATACCACGATTCTGTGGCTCCGAG
>probe:Drosophila_2:1626604_at:304:347; Interrogation_Position=781; Antisense; GCAGGAACTGCACCAAGCCGTTAAT
>probe:Drosophila_2:1626604_at:90:3; Interrogation_Position=804; Antisense; ATAGGGTATTCTCCGTTACGATCCA
>probe:Drosophila_2:1626604_at:729:669; Interrogation_Position=820; Antisense; TACGATCCAGGATGCGATTTCCATT
>probe:Drosophila_2:1626604_at:673:463; Interrogation_Position=851; Antisense; GATTCCTAAGTGTGCAGTCGTCTGA
>probe:Drosophila_2:1626604_at:500:329; Interrogation_Position=906; Antisense; GCGGAAGTAACCTAACCAGTGACCT

Paste this into a BLAST search page for me
ATTGCTGTCCCGATCAGGAGGTATAGTATATCAGCCCATGAATCGCCGCAGAACCACCACTTTCGGCTATTGAAAGAAAAGCACCTCTTCCAGATGAGTAGTATCTTTTGCAAGTCCGTCAGGGCTGTAAAGTAGGTCGACGTCCGCCCAGGAGGCCATCCGAATGCTGCAAGAAGAAGTTCACTCCGATGCCTAGTTTTGATACCACGATTCTGTGGCTCCGAGGCAGGAACTGCACCAAGCCGTTAATATAGGGTATTCTCCGTTACGATCCATACGATCCAGGATGCGATTTCCATTGATTCCTAAGTGTGCAGTCGTCTGAGCGGAAGTAACCTAACCAGTGACCT

Full Affymetrix probeset data:

Annotations for 1626604_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720