FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626605_at:

>probe:Drosophila_2:1626605_at:648:33; Interrogation_Position=133; Antisense; ATCGACCTGGACGACGGCGTAGATG
>probe:Drosophila_2:1626605_at:385:587; Interrogation_Position=161; Antisense; TGGACCTGCCACTGGAGGTGGAACA
>probe:Drosophila_2:1626605_at:592:405; Interrogation_Position=238; Antisense; GACTGGCTGACCTTCGACGAACCCA
>probe:Drosophila_2:1626605_at:57:137; Interrogation_Position=271; Antisense; ACGAAGCATCGGTCTGGCCACAAGC
>probe:Drosophila_2:1626605_at:518:413; Interrogation_Position=318; Antisense; GACCAGCGGATTCCACAAGCTTTCC
>probe:Drosophila_2:1626605_at:659:401; Interrogation_Position=350; Antisense; GACATCGCACCTGCCACGTGGAAAT
>probe:Drosophila_2:1626605_at:458:289; Interrogation_Position=366; Antisense; CGTGGAAATCGTCAGCAAGGTGCAA
>probe:Drosophila_2:1626605_at:212:81; Interrogation_Position=383; Antisense; AGGTGCAAGGTATCTGCCAGCCGAT
>probe:Drosophila_2:1626605_at:117:507; Interrogation_Position=41; Antisense; GTGCCACCACTCTGCTGATTGCCAA
>probe:Drosophila_2:1626605_at:561:123; Interrogation_Position=418; Antisense; AGCGCTTGCGTCTCGGATGACTACA
>probe:Drosophila_2:1626605_at:40:547; Interrogation_Position=432; Antisense; GGATGACTACATGGACCTCTACACC
>probe:Drosophila_2:1626605_at:500:293; Interrogation_Position=456; Antisense; CGATGCCAACTGCTCATCTCAATAG
>probe:Drosophila_2:1626605_at:138:3; Interrogation_Position=58; Antisense; ATTGCCAACGCCCTGGTACTGAGTC
>probe:Drosophila_2:1626605_at:134:433; Interrogation_Position=78; Antisense; GAGTCCCCAATTACTGGGTGCAGAA

Paste this into a BLAST search page for me
ATCGACCTGGACGACGGCGTAGATGTGGACCTGCCACTGGAGGTGGAACAGACTGGCTGACCTTCGACGAACCCAACGAAGCATCGGTCTGGCCACAAGCGACCAGCGGATTCCACAAGCTTTCCGACATCGCACCTGCCACGTGGAAATCGTGGAAATCGTCAGCAAGGTGCAAAGGTGCAAGGTATCTGCCAGCCGATGTGCCACCACTCTGCTGATTGCCAAAGCGCTTGCGTCTCGGATGACTACAGGATGACTACATGGACCTCTACACCCGATGCCAACTGCTCATCTCAATAGATTGCCAACGCCCTGGTACTGAGTCGAGTCCCCAATTACTGGGTGCAGAA

Full Affymetrix probeset data:

Annotations for 1626605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720