FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626609_at:

>probe:Drosophila_2:1626609_at:693:439; Interrogation_Position=1111; Antisense; GATGGCTTGCACAATCTGACCGATG
>probe:Drosophila_2:1626609_at:213:25; Interrogation_Position=1144; Antisense; ATAGGTGCAGCCTTCGCAAGTGATC
>probe:Drosophila_2:1626609_at:446:53; Interrogation_Position=1208; Antisense; ATGAGTTGCCACACGAACTGGGCGA
>probe:Drosophila_2:1626609_at:506:195; Interrogation_Position=1223; Antisense; AACTGGGCGACTTTGCTCTGTTGCT
>probe:Drosophila_2:1626609_at:509:603; Interrogation_Position=1241; Antisense; TGTTGCTGCAAACAGGTGTCTCCAT
>probe:Drosophila_2:1626609_at:4:517; Interrogation_Position=1256; Antisense; GTGTCTCCATGCGAAGAGCCGTCTA
>probe:Drosophila_2:1626609_at:632:337; Interrogation_Position=1295; Antisense; GCTCAGTTCTTAGCTTTGTGGGCAT
>probe:Drosophila_2:1626609_at:665:639; Interrogation_Position=1321; Antisense; TCGGTGGGTCTCTTTATTGCTGGAA
>probe:Drosophila_2:1626609_at:356:551; Interrogation_Position=1348; Antisense; GGAGACGGCATGACCCAATGGATTT
>probe:Drosophila_2:1626609_at:510:229; Interrogation_Position=1364; Antisense; AATGGATTTATGCAGCCACCGCTGG
>probe:Drosophila_2:1626609_at:390:469; Interrogation_Position=1388; Antisense; GTTCCTTCCTGTATATTGCTTTTGC
>probe:Drosophila_2:1626609_at:400:231; Interrogation_Position=1515; Antisense; AATGTTGGCTATTGCCCTCAATGAA
>probe:Drosophila_2:1626609_at:482:99; Interrogation_Position=1548; Antisense; AGAGGGCCTGTTCAAGAGCTTTTAA
>probe:Drosophila_2:1626609_at:194:225; Interrogation_Position=991; Antisense; AAGGATGCTATTGATCTGCCACCTC

Paste this into a BLAST search page for me
GATGGCTTGCACAATCTGACCGATGATAGGTGCAGCCTTCGCAAGTGATCATGAGTTGCCACACGAACTGGGCGAAACTGGGCGACTTTGCTCTGTTGCTTGTTGCTGCAAACAGGTGTCTCCATGTGTCTCCATGCGAAGAGCCGTCTAGCTCAGTTCTTAGCTTTGTGGGCATTCGGTGGGTCTCTTTATTGCTGGAAGGAGACGGCATGACCCAATGGATTTAATGGATTTATGCAGCCACCGCTGGGTTCCTTCCTGTATATTGCTTTTGCAATGTTGGCTATTGCCCTCAATGAAAGAGGGCCTGTTCAAGAGCTTTTAAAAGGATGCTATTGATCTGCCACCTC

Full Affymetrix probeset data:

Annotations for 1626609_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720