FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626613_at:

>probe:Drosophila_2:1626613_at:436:409; Interrogation_Position=1007; Antisense; GACGATGTCCTCAATATCCTGTTGG
>probe:Drosophila_2:1626613_at:222:487; Interrogation_Position=572; Antisense; GTAGCCGATTCCGAGTACGATGTGA
>probe:Drosophila_2:1626613_at:87:247; Interrogation_Position=602; Antisense; AATTGCTCCGGATTGGGCTCTAAGA
>probe:Drosophila_2:1626613_at:601:571; Interrogation_Position=617; Antisense; GGCTCTAAGACCCTACTAAACGACG
>probe:Drosophila_2:1626613_at:720:485; Interrogation_Position=649; Antisense; GTACGCAGTGCGTGGCCAAGTTTCC
>probe:Drosophila_2:1626613_at:480:195; Interrogation_Position=686; Antisense; AACTGGATTTTCTCTGCCGTGCTGG
>probe:Drosophila_2:1626613_at:507:259; Interrogation_Position=745; Antisense; CACCGAAAGTGTTGTCCTGGGCGGA
>probe:Drosophila_2:1626613_at:709:559; Interrogation_Position=767; Antisense; GGAACCCATCAGGAGCGGGACTACA
>probe:Drosophila_2:1626613_at:464:219; Interrogation_Position=798; Antisense; AAGTCTGCCAGAACGACAGGCGGAT
>probe:Drosophila_2:1626613_at:204:59; Interrogation_Position=821; Antisense; ATGATCGTCGATGGCTGTCAGCGGT
>probe:Drosophila_2:1626613_at:534:495; Interrogation_Position=837; Antisense; GTCAGCGGTACATTCCTGGTTTGGA
>probe:Drosophila_2:1626613_at:198:553; Interrogation_Position=859; Antisense; GGAGCACACGGAGTGCCTCTTTGAT
>probe:Drosophila_2:1626613_at:6:273; Interrogation_Position=875; Antisense; CTCTTTGATTGGGTAGGTCTCCGGC
>probe:Drosophila_2:1626613_at:65:401; Interrogation_Position=966; Antisense; GACATGGCGGCAGTGGAGTCACTTT

Paste this into a BLAST search page for me
GACGATGTCCTCAATATCCTGTTGGGTAGCCGATTCCGAGTACGATGTGAAATTGCTCCGGATTGGGCTCTAAGAGGCTCTAAGACCCTACTAAACGACGGTACGCAGTGCGTGGCCAAGTTTCCAACTGGATTTTCTCTGCCGTGCTGGCACCGAAAGTGTTGTCCTGGGCGGAGGAACCCATCAGGAGCGGGACTACAAAGTCTGCCAGAACGACAGGCGGATATGATCGTCGATGGCTGTCAGCGGTGTCAGCGGTACATTCCTGGTTTGGAGGAGCACACGGAGTGCCTCTTTGATCTCTTTGATTGGGTAGGTCTCCGGCGACATGGCGGCAGTGGAGTCACTTT

Full Affymetrix probeset data:

Annotations for 1626613_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720