Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626615_at:

>probe:Drosophila_2:1626615_at:80:451; Interrogation_Position=2594; Antisense; GATCGCATTGCCAAGCAGCACAAGC
>probe:Drosophila_2:1626615_at:643:357; Interrogation_Position=2611; Antisense; GCACAAGCTGCCCATGGAGCGATTG
>probe:Drosophila_2:1626615_at:688:1; Interrogation_Position=2632; Antisense; ATTGGAGTTCCTGTTGGTTGCCCTG
>probe:Drosophila_2:1626615_at:595:353; Interrogation_Position=2656; Antisense; GCAGCGCGAATTACTTCAGGATTAT
>probe:Drosophila_2:1626615_at:313:41; Interrogation_Position=2688; Antisense; ATCTGGACAAGAGGCCACTGTTCAA
>probe:Drosophila_2:1626615_at:399:535; Interrogation_Position=2717; Antisense; GGTCTAACTAGGCTGGATGATCTTA
>probe:Drosophila_2:1626615_at:24:585; Interrogation_Position=2761; Antisense; TGGCAAGTGCCGTGACCAACGTAAC
>probe:Drosophila_2:1626615_at:148:265; Interrogation_Position=2787; Antisense; CAGTTTGGCGCCTTCGTGGACGTTG
>probe:Drosophila_2:1626615_at:492:433; Interrogation_Position=2812; Antisense; GAGTGGAGCGCAATGGCCTCATACA
>probe:Drosophila_2:1626615_at:259:353; Interrogation_Position=2858; Antisense; GCAGCTGAGCGTTGGCGATCGCATT
>probe:Drosophila_2:1626615_at:630:43; Interrogation_Position=2875; Antisense; ATCGCATTGTGGCATCGGTGGTAAA
>probe:Drosophila_2:1626615_at:216:123; Interrogation_Position=2911; Antisense; AGCGACGCCAGTTGGAATTACGTTT
>probe:Drosophila_2:1626615_at:673:245; Interrogation_Position=2952; Antisense; GAGACGGATACCTCGTTTAAGTTCA
>probe:Drosophila_2:1626615_at:499:653; Interrogation_Position=3041; Antisense; TAATTGTTTGGTTGCTCACACGAGC

Paste this into a BLAST search page for me
GATCGCATTGCCAAGCAGCACAAGCGCACAAGCTGCCCATGGAGCGATTGATTGGAGTTCCTGTTGGTTGCCCTGGCAGCGCGAATTACTTCAGGATTATATCTGGACAAGAGGCCACTGTTCAAGGTCTAACTAGGCTGGATGATCTTATGGCAAGTGCCGTGACCAACGTAACCAGTTTGGCGCCTTCGTGGACGTTGGAGTGGAGCGCAATGGCCTCATACAGCAGCTGAGCGTTGGCGATCGCATTATCGCATTGTGGCATCGGTGGTAAAAGCGACGCCAGTTGGAATTACGTTTGAGACGGATACCTCGTTTAAGTTCATAATTGTTTGGTTGCTCACACGAGC

Full Affymetrix probeset data:

Annotations for 1626615_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime