FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626616_at:

>probe:Drosophila_2:1626616_at:650:319; Interrogation_Position=1017; Antisense; GCCGCCACTAAATCATCCGATAAAG
>probe:Drosophila_2:1626616_at:600:631; Interrogation_Position=1032; Antisense; TCCGATAAAGGCTTCACTAGGTGAT
>probe:Drosophila_2:1626616_at:305:279; Interrogation_Position=1048; Antisense; CTAGGTGATCGAATTGTGCTCATTT
>probe:Drosophila_2:1626616_at:87:605; Interrogation_Position=1067; Antisense; TCATTTTTGAGTGCAGACCCTACTA
>probe:Drosophila_2:1626616_at:679:409; Interrogation_Position=1082; Antisense; GACCCTACTATTAGAATACCTCTTT
>probe:Drosophila_2:1626616_at:208:303; Interrogation_Position=603; Antisense; CCGCTCCTGTCGTGGTTGAGGCTGA
>probe:Drosophila_2:1626616_at:618:609; Interrogation_Position=637; Antisense; TGAGCTGGCCGATGACGGTTACCGT
>probe:Drosophila_2:1626616_at:360:159; Interrogation_Position=663; Antisense; ACAAGACCCATCGTCGCGTTGTTTA
>probe:Drosophila_2:1626616_at:463:429; Interrogation_Position=758; Antisense; GAGTACCTGGCTCCCGCTGAGACTG
>probe:Drosophila_2:1626616_at:139:609; Interrogation_Position=775; Antisense; TGAGACTGCTCCTGAGACCGACTTG
>probe:Drosophila_2:1626616_at:705:131; Interrogation_Position=791; Antisense; ACCGACTTGGCCGTTGATGGATACC
>probe:Drosophila_2:1626616_at:238:265; Interrogation_Position=932; Antisense; CAGGAAAACACCGTCGAGGCGGCTC
>probe:Drosophila_2:1626616_at:207:303; Interrogation_Position=957; Antisense; CCGCCCATGTCCTGGCTGATGATGG
>probe:Drosophila_2:1626616_at:53:161; Interrogation_Position=999; Antisense; ACAAGCGCGTTGTGTTGCGCCGCCA

Paste this into a BLAST search page for me
GCCGCCACTAAATCATCCGATAAAGTCCGATAAAGGCTTCACTAGGTGATCTAGGTGATCGAATTGTGCTCATTTTCATTTTTGAGTGCAGACCCTACTAGACCCTACTATTAGAATACCTCTTTCCGCTCCTGTCGTGGTTGAGGCTGATGAGCTGGCCGATGACGGTTACCGTACAAGACCCATCGTCGCGTTGTTTAGAGTACCTGGCTCCCGCTGAGACTGTGAGACTGCTCCTGAGACCGACTTGACCGACTTGGCCGTTGATGGATACCCAGGAAAACACCGTCGAGGCGGCTCCCGCCCATGTCCTGGCTGATGATGGACAAGCGCGTTGTGTTGCGCCGCCA

Full Affymetrix probeset data:

Annotations for 1626616_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720