FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626617_at:

>probe:Drosophila_2:1626617_at:17:457; Interrogation_Position=3274; Antisense; GATAGACTTGTCTCACTTGTCTTGG
>probe:Drosophila_2:1626617_at:567:149; Interrogation_Position=3288; Antisense; ACTTGTCTTGGCCATTTAATCTCTT
>probe:Drosophila_2:1626617_at:514:579; Interrogation_Position=3297; Antisense; GGCCATTTAATCTCTTTCATTCAGC
>probe:Drosophila_2:1626617_at:290:377; Interrogation_Position=3374; Antisense; GAAGCATAGTTGTAACGCAGCCAGA
>probe:Drosophila_2:1626617_at:338:353; Interrogation_Position=3390; Antisense; GCAGCCAGATATTCCATTACGCATA
>probe:Drosophila_2:1626617_at:724:19; Interrogation_Position=3450; Antisense; ATATTTTAACATAGCCCCATAGCCA
>probe:Drosophila_2:1626617_at:52:321; Interrogation_Position=3463; Antisense; GCCCCATAGCCATACGACATAACAA
>probe:Drosophila_2:1626617_at:511:683; Interrogation_Position=3498; Antisense; TATCGAATCCCTTGCATACATTTGA
>probe:Drosophila_2:1626617_at:447:469; Interrogation_Position=3529; Antisense; GTTGCTTTCATATTGATATCATCGA
>probe:Drosophila_2:1626617_at:111:271; Interrogation_Position=3548; Antisense; CATCGAGCATCGAACGAACTATCGT
>probe:Drosophila_2:1626617_at:384:385; Interrogation_Position=3563; Antisense; GAACTATCGTATACATCGCCAATAT
>probe:Drosophila_2:1626617_at:681:87; Interrogation_Position=3615; Antisense; AGATCGTACGGACAGCTAGCGGCTA
>probe:Drosophila_2:1626617_at:88:413; Interrogation_Position=3642; Antisense; GACCGCGCCACCATATTTGATATAT
>probe:Drosophila_2:1626617_at:391:247; Interrogation_Position=3741; Antisense; AATTCCACACCATTTATGTATGCAT

Paste this into a BLAST search page for me
GATAGACTTGTCTCACTTGTCTTGGACTTGTCTTGGCCATTTAATCTCTTGGCCATTTAATCTCTTTCATTCAGCGAAGCATAGTTGTAACGCAGCCAGAGCAGCCAGATATTCCATTACGCATAATATTTTAACATAGCCCCATAGCCAGCCCCATAGCCATACGACATAACAATATCGAATCCCTTGCATACATTTGAGTTGCTTTCATATTGATATCATCGACATCGAGCATCGAACGAACTATCGTGAACTATCGTATACATCGCCAATATAGATCGTACGGACAGCTAGCGGCTAGACCGCGCCACCATATTTGATATATAATTCCACACCATTTATGTATGCAT

Full Affymetrix probeset data:

Annotations for 1626617_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720