Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626619_at:

>probe:Drosophila_2:1626619_at:725:213; Interrogation_Position=1091; Antisense; AAGAGAGATCCGGTCATGTCGTCCA
>probe:Drosophila_2:1626619_at:696:61; Interrogation_Position=1106; Antisense; ATGTCGTCCACAATAGAAACTGCAG
>probe:Drosophila_2:1626619_at:462:199; Interrogation_Position=1131; Antisense; AACGCAGTGAATACACGCTGATATT
>probe:Drosophila_2:1626619_at:617:607; Interrogation_Position=1182; Antisense; TGAGGCACAAGTGCGGGCTGTTCTC
>probe:Drosophila_2:1626619_at:686:453; Interrogation_Position=1210; Antisense; GATCACAGGAGCAGTGCGTCCAGGA
>probe:Drosophila_2:1626619_at:405:255; Interrogation_Position=1268; Antisense; GAATCGTAGCTCATTTTAAGCCCAC
>probe:Drosophila_2:1626619_at:12:659; Interrogation_Position=1284; Antisense; TAAGCCCACTATGGATTGCATCCGC
>probe:Drosophila_2:1626619_at:361:619; Interrogation_Position=1300; Antisense; TGCATCCGCTGGTGTACCATGTATA
>probe:Drosophila_2:1626619_at:614:237; Interrogation_Position=1327; Antisense; AATCGTGCACGAAATACTCGCTTGT
>probe:Drosophila_2:1626619_at:336:191; Interrogation_Position=1422; Antisense; AACTAACGCTGATCGGAAAGGCCAA
>probe:Drosophila_2:1626619_at:126:395; Interrogation_Position=1437; Antisense; GAAAGGCCAACTATTGTATCTGCAT
>probe:Drosophila_2:1626619_at:155:203; Interrogation_Position=1474; Antisense; AACCTATCACTTGGAGTCCTTCACG
>probe:Drosophila_2:1626619_at:390:387; Interrogation_Position=1554; Antisense; GAAAATACTCTGAACACGTCTCGCC
>probe:Drosophila_2:1626619_at:291:315; Interrogation_Position=1576; Antisense; GCCTTCAGCGCTCGTTTAATTGTTA

Paste this into a BLAST search page for me
AAGAGAGATCCGGTCATGTCGTCCAATGTCGTCCACAATAGAAACTGCAGAACGCAGTGAATACACGCTGATATTTGAGGCACAAGTGCGGGCTGTTCTCGATCACAGGAGCAGTGCGTCCAGGAGAATCGTAGCTCATTTTAAGCCCACTAAGCCCACTATGGATTGCATCCGCTGCATCCGCTGGTGTACCATGTATAAATCGTGCACGAAATACTCGCTTGTAACTAACGCTGATCGGAAAGGCCAAGAAAGGCCAACTATTGTATCTGCATAACCTATCACTTGGAGTCCTTCACGGAAAATACTCTGAACACGTCTCGCCGCCTTCAGCGCTCGTTTAATTGTTA

Full Affymetrix probeset data:

Annotations for 1626619_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime