FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626620_at:

>probe:Drosophila_2:1626620_at:613:273; Interrogation_Position=1063; Antisense; CTTCAATGTAATGCTGGGCTCCCAG
>probe:Drosophila_2:1626620_at:227:525; Interrogation_Position=1078; Antisense; GGGCTCCCAGTTGCTGTACAAATTC
>probe:Drosophila_2:1626620_at:26:383; Interrogation_Position=1103; Antisense; GAACGCACCCAGTACGCGGATGTGA
>probe:Drosophila_2:1626620_at:217:53; Interrogation_Position=1127; Antisense; ATGCAGAAGCATCCGGACACACCGT
>probe:Drosophila_2:1626620_at:561:401; Interrogation_Position=1157; Antisense; GAGCTTTACGGATCTTTTCACCTGC
>probe:Drosophila_2:1626620_at:251:233; Interrogation_Position=1207; Antisense; AATGCTCAGCTACTCTGCGTTGGAT
>probe:Drosophila_2:1626620_at:42:543; Interrogation_Position=1228; Antisense; GGATCAGCAGTCCATGCAGAACCTA
>probe:Drosophila_2:1626620_at:282:651; Interrogation_Position=1254; Antisense; TCACGCACGTGCAGGATTTCCTTAA
>probe:Drosophila_2:1626620_at:588:197; Interrogation_Position=1328; Antisense; AACGTTGATCCCGAGTACGTGCGAA
>probe:Drosophila_2:1626620_at:675:249; Interrogation_Position=1413; Antisense; CAATAATTCGGTGGTTGCTCTCAAT
>probe:Drosophila_2:1626620_at:655:541; Interrogation_Position=1425; Antisense; GGTTGCTCTCAATTTGCTCCCAAAT
>probe:Drosophila_2:1626620_at:489:79; Interrogation_Position=948; Antisense; AGGTTACCGTGCAGCAGATCTCTGA
>probe:Drosophila_2:1626620_at:499:39; Interrogation_Position=965; Antisense; ATCTCTGAGCAGTATTTGGCGCACA
>probe:Drosophila_2:1626620_at:597:631; Interrogation_Position=995; Antisense; TCCGTGAAATCGACCAGTGCCAGCA

Paste this into a BLAST search page for me
CTTCAATGTAATGCTGGGCTCCCAGGGGCTCCCAGTTGCTGTACAAATTCGAACGCACCCAGTACGCGGATGTGAATGCAGAAGCATCCGGACACACCGTGAGCTTTACGGATCTTTTCACCTGCAATGCTCAGCTACTCTGCGTTGGATGGATCAGCAGTCCATGCAGAACCTATCACGCACGTGCAGGATTTCCTTAAAACGTTGATCCCGAGTACGTGCGAACAATAATTCGGTGGTTGCTCTCAATGGTTGCTCTCAATTTGCTCCCAAATAGGTTACCGTGCAGCAGATCTCTGAATCTCTGAGCAGTATTTGGCGCACATCCGTGAAATCGACCAGTGCCAGCA

Full Affymetrix probeset data:

Annotations for 1626620_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720