Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626621_at:

>probe:Drosophila_2:1626621_at:455:319; Interrogation_Position=1062; Antisense; GCCGAATGGCGATCTGCCAGTTTAA
>probe:Drosophila_2:1626621_at:284:485; Interrogation_Position=1111; Antisense; GTATGTTTTTGTACCATAGAGCCAA
>probe:Drosophila_2:1626621_at:371:677; Interrogation_Position=1127; Antisense; TAGAGCCAAGTAAACTGCCAGATTT
>probe:Drosophila_2:1626621_at:459:627; Interrogation_Position=1142; Antisense; TGCCAGATTTGTCAGCGTTGCGGTT
>probe:Drosophila_2:1626621_at:721:495; Interrogation_Position=1152; Antisense; GTCAGCGTTGCGGTTCTTAGTAAGC
>probe:Drosophila_2:1626621_at:398:217; Interrogation_Position=1181; Antisense; AAGTTACCTCTATGCAATTCATCAG
>probe:Drosophila_2:1626621_at:123:363; Interrogation_Position=1194; Antisense; GCAATTCATCAGCTGTTTAGTGTAG
>probe:Drosophila_2:1626621_at:574:497; Interrogation_Position=1301; Antisense; GTCATTGGTTTCACACACGCATTTA
>probe:Drosophila_2:1626621_at:553:439; Interrogation_Position=1381; Antisense; GATGGTGTTATCCTCCGAAGATTTG
>probe:Drosophila_2:1626621_at:224:375; Interrogation_Position=1397; Antisense; GAAGATTTGTACCTTGCTAATGCAT
>probe:Drosophila_2:1626621_at:52:345; Interrogation_Position=1418; Antisense; GCATTCATGAAACCAACTATCCTTG
>probe:Drosophila_2:1626621_at:705:105; Interrogation_Position=1482; Antisense; AGCAATGAGATTTCAGTACACACTA
>probe:Drosophila_2:1626621_at:1:491; Interrogation_Position=1497; Antisense; GTACACACTATTAACACACACGGAA
>probe:Drosophila_2:1626621_at:100:273; Interrogation_Position=1588; Antisense; CTTACTTTGTACACCTTAATGCCCA

Paste this into a BLAST search page for me
GCCGAATGGCGATCTGCCAGTTTAAGTATGTTTTTGTACCATAGAGCCAATAGAGCCAAGTAAACTGCCAGATTTTGCCAGATTTGTCAGCGTTGCGGTTGTCAGCGTTGCGGTTCTTAGTAAGCAAGTTACCTCTATGCAATTCATCAGGCAATTCATCAGCTGTTTAGTGTAGGTCATTGGTTTCACACACGCATTTAGATGGTGTTATCCTCCGAAGATTTGGAAGATTTGTACCTTGCTAATGCATGCATTCATGAAACCAACTATCCTTGAGCAATGAGATTTCAGTACACACTAGTACACACTATTAACACACACGGAACTTACTTTGTACACCTTAATGCCCA

Full Affymetrix probeset data:

Annotations for 1626621_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime