FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626622_at:

>probe:Drosophila_2:1626622_at:393:219; Interrogation_Position=1050; Antisense; AAGTCGGCGCTGGACGTATGTGCTA
>probe:Drosophila_2:1626622_at:62:93; Interrogation_Position=552; Antisense; AGTTTCAGCCATACGAGAGGGTCCT
>probe:Drosophila_2:1626622_at:470:347; Interrogation_Position=624; Antisense; GCATCGATCGATGTGACGCTCTAAT
>probe:Drosophila_2:1626622_at:219:411; Interrogation_Position=638; Antisense; GACGCTCTAATGTTGGCCCAGGTGG
>probe:Drosophila_2:1626622_at:191:447; Interrogation_Position=706; Antisense; GATGCGCCTGCGAATGGTTCAGATC
>probe:Drosophila_2:1626622_at:219:481; Interrogation_Position=780; Antisense; GTTTGGATCGTTCCTATGTCAGCTC
>probe:Drosophila_2:1626622_at:249:657; Interrogation_Position=837; Antisense; TAAGTGCCTGCAAGGACACCACGTC
>probe:Drosophila_2:1626622_at:18:501; Interrogation_Position=859; Antisense; GTCGCTCTACAACCTGGACAAGGAG
>probe:Drosophila_2:1626622_at:636:73; Interrogation_Position=879; Antisense; AGGAGCGCATGTTTGATGGCATTCA
>probe:Drosophila_2:1626622_at:43:67; Interrogation_Position=894; Antisense; ATGGCATTCAAATCCTGTACCGCAT
>probe:Drosophila_2:1626622_at:681:671; Interrogation_Position=911; Antisense; TACCGCATGCTCTGCAAACGTCGAG
>probe:Drosophila_2:1626622_at:241:177; Interrogation_Position=926; Antisense; AAACGTCGAGACATTGTTCCCAGCT
>probe:Drosophila_2:1626622_at:728:339; Interrogation_Position=948; Antisense; GCTACCACAGCTATGAGATCGACAA
>probe:Drosophila_2:1626622_at:95:241; Interrogation_Position=997; Antisense; AATAAGTCTTCTTTCATCGGTCCTC

Paste this into a BLAST search page for me
AAGTCGGCGCTGGACGTATGTGCTAAGTTTCAGCCATACGAGAGGGTCCTGCATCGATCGATGTGACGCTCTAATGACGCTCTAATGTTGGCCCAGGTGGGATGCGCCTGCGAATGGTTCAGATCGTTTGGATCGTTCCTATGTCAGCTCTAAGTGCCTGCAAGGACACCACGTCGTCGCTCTACAACCTGGACAAGGAGAGGAGCGCATGTTTGATGGCATTCAATGGCATTCAAATCCTGTACCGCATTACCGCATGCTCTGCAAACGTCGAGAAACGTCGAGACATTGTTCCCAGCTGCTACCACAGCTATGAGATCGACAAAATAAGTCTTCTTTCATCGGTCCTC

Full Affymetrix probeset data:

Annotations for 1626622_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720