FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626623_at:

>probe:Drosophila_2:1626623_at:182:389; Interrogation_Position=1014; Antisense; GAAAAATCGCGATACTTGCCAGGGC
>probe:Drosophila_2:1626623_at:42:463; Interrogation_Position=1039; Antisense; GATTCTGGAGGACCGCTTCAACTGA
>probe:Drosophila_2:1626623_at:176:195; Interrogation_Position=1058; Antisense; AACTGAACTTGGAACGTCGGCGTCG
>probe:Drosophila_2:1626623_at:579:179; Interrogation_Position=1099; Antisense; AAACACTATCGCTACTACCTGGTGG
>probe:Drosophila_2:1626623_at:48:519; Interrogation_Position=1120; Antisense; GTGGGCATCACATCGTATGGAGCAT
>probe:Drosophila_2:1626623_at:508:685; Interrogation_Position=1144; Antisense; TATTGTCGCAGTGAACTTCCAGGGA
>probe:Drosophila_2:1626623_at:495:87; Interrogation_Position=1280; Antisense; AGTCCATTGGTTGCGACATTTTCAA
>probe:Drosophila_2:1626623_at:428:151; Interrogation_Position=1295; Antisense; ACATTTTCAATGACGCCGCCATGGA
>probe:Drosophila_2:1626623_at:322:561; Interrogation_Position=1317; Antisense; GGAAAACGCCTACTATGTCTGCCAT
>probe:Drosophila_2:1626623_at:643:359; Interrogation_Position=839; Antisense; GCAAGCTGCACACCATGGGCTATGG
>probe:Drosophila_2:1626623_at:547:29; Interrogation_Position=895; Antisense; ATACTCACGGAACTGGATCTCTCGG
>probe:Drosophila_2:1626623_at:579:639; Interrogation_Position=916; Antisense; TCGGTGGTGCCCATTGAGCAGTGTA
>probe:Drosophila_2:1626623_at:451:419; Interrogation_Position=931; Antisense; GAGCAGTGTAACTCCAGTCTGCCAG
>probe:Drosophila_2:1626623_at:208:281; Interrogation_Position=982; Antisense; CTCACAAGTCAGATATGCGCCCATG

Paste this into a BLAST search page for me
GAAAAATCGCGATACTTGCCAGGGCGATTCTGGAGGACCGCTTCAACTGAAACTGAACTTGGAACGTCGGCGTCGAAACACTATCGCTACTACCTGGTGGGTGGGCATCACATCGTATGGAGCATTATTGTCGCAGTGAACTTCCAGGGAAGTCCATTGGTTGCGACATTTTCAAACATTTTCAATGACGCCGCCATGGAGGAAAACGCCTACTATGTCTGCCATGCAAGCTGCACACCATGGGCTATGGATACTCACGGAACTGGATCTCTCGGTCGGTGGTGCCCATTGAGCAGTGTAGAGCAGTGTAACTCCAGTCTGCCAGCTCACAAGTCAGATATGCGCCCATG

Full Affymetrix probeset data:

Annotations for 1626623_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720