Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626624_s_at:

>probe:Drosophila_2:1626624_s_at:632:223; Interrogation_Position=1645; Antisense; AAGGAGGATCCTTCTTTGATCACGA
>probe:Drosophila_2:1626624_s_at:476:723; Interrogation_Position=1660; Antisense; TTGATCACGAGGGACTGCCGTACTG
>probe:Drosophila_2:1626624_s_at:253:129; Interrogation_Position=1696; Antisense; ACCATGCCAAGCGAGGATCCCTGTG
>probe:Drosophila_2:1626624_s_at:49:285; Interrogation_Position=1751; Antisense; CTGCATCACGGCCATGTTCAAGAAA
>probe:Drosophila_2:1626624_s_at:24:271; Interrogation_Position=1763; Antisense; CATGTTCAAGAAATTCCACCCGGAA
>probe:Drosophila_2:1626624_s_at:677:321; Interrogation_Position=1798; Antisense; GCGCCTTCTGCCTGAAGCAGTTGAA
>probe:Drosophila_2:1626624_s_at:158:185; Interrogation_Position=1843; Antisense; AAAAGGACAAGCCATACTGCCACAC
>probe:Drosophila_2:1626624_s_at:442:311; Interrogation_Position=1861; Antisense; GCCACACCTGCTTCGACAAGATATT
>probe:Drosophila_2:1626624_s_at:519:547; Interrogation_Position=1887; Antisense; GGATGAAGATATTCGCAGCTGCCAA
>probe:Drosophila_2:1626624_s_at:38:719; Interrogation_Position=1898; Antisense; TTCGCAGCTGCCAAACTCTAGTTAT
>probe:Drosophila_2:1626624_s_at:211:491; Interrogation_Position=2008; Antisense; GTACACCTACTTACCGTGCATCTGT
>probe:Drosophila_2:1626624_s_at:362:509; Interrogation_Position=2023; Antisense; GTGCATCTGTGCTTTGTATAACCGA
>probe:Drosophila_2:1626624_s_at:332:709; Interrogation_Position=2062; Antisense; TTAATTAACGCCATCCGAGCAGGAT
>probe:Drosophila_2:1626624_s_at:240:725; Interrogation_Position=2152; Antisense; TTGATATTGCTACTCGTTCGACATG

Paste this into a BLAST search page for me
AAGGAGGATCCTTCTTTGATCACGATTGATCACGAGGGACTGCCGTACTGACCATGCCAAGCGAGGATCCCTGTGCTGCATCACGGCCATGTTCAAGAAACATGTTCAAGAAATTCCACCCGGAAGCGCCTTCTGCCTGAAGCAGTTGAAAAAAGGACAAGCCATACTGCCACACGCCACACCTGCTTCGACAAGATATTGGATGAAGATATTCGCAGCTGCCAATTCGCAGCTGCCAAACTCTAGTTATGTACACCTACTTACCGTGCATCTGTGTGCATCTGTGCTTTGTATAACCGATTAATTAACGCCATCCGAGCAGGATTTGATATTGCTACTCGTTCGACATG

Full Affymetrix probeset data:

Annotations for 1626624_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime