FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626630_at:

>probe:Drosophila_2:1626630_at:385:173; Interrogation_Position=1117; Antisense; AAAGCACTGCACGAAACGCATCAAG
>probe:Drosophila_2:1626630_at:521:325; Interrogation_Position=1141; Antisense; GCGACACCGCACAAAAAGAACCAAG
>probe:Drosophila_2:1626630_at:530:379; Interrogation_Position=1158; Antisense; GAACCAAGCGATCGAAATCCACCAA
>probe:Drosophila_2:1626630_at:74:91; Interrogation_Position=1189; Antisense; AGTACATCATCATAACCGTCCAGGA
>probe:Drosophila_2:1626630_at:623:201; Interrogation_Position=1202; Antisense; AACCGTCCAGGAACGACACCAGAAT
>probe:Drosophila_2:1626630_at:485:613; Interrogation_Position=1284; Antisense; TGAAGGACCTGCTAACACCGAAGTG
>probe:Drosophila_2:1626630_at:481:373; Interrogation_Position=1303; Antisense; GAAGTGCCCCGATTCCAAATCGAAG
>probe:Drosophila_2:1626630_at:324:373; Interrogation_Position=1324; Antisense; GAAGTCTCAAGCTTCGTGCAAGCCT
>probe:Drosophila_2:1626630_at:184:617; Interrogation_Position=1340; Antisense; TGCAAGCCTGCACCCAAGTGTAAAT
>probe:Drosophila_2:1626630_at:107:393; Interrogation_Position=1378; Antisense; GAAAGCCGCATCGAAAGCCACATCT
>probe:Drosophila_2:1626630_at:33:205; Interrogation_Position=1392; Antisense; AAGCCACATCTAAGCCAAAGCCAAA
>probe:Drosophila_2:1626630_at:662:309; Interrogation_Position=1412; Antisense; CCAAAGGCGTGTGATTCAGGCAAGA
>probe:Drosophila_2:1626630_at:426:1; Interrogation_Position=1434; Antisense; AGAAGAACACCACCAAGAAACCGCG
>probe:Drosophila_2:1626630_at:337:391; Interrogation_Position=1450; Antisense; GAAACCGCGGAAGACTCAGCCACAA

Paste this into a BLAST search page for me
AAAGCACTGCACGAAACGCATCAAGGCGACACCGCACAAAAAGAACCAAGGAACCAAGCGATCGAAATCCACCAAAGTACATCATCATAACCGTCCAGGAAACCGTCCAGGAACGACACCAGAATTGAAGGACCTGCTAACACCGAAGTGGAAGTGCCCCGATTCCAAATCGAAGGAAGTCTCAAGCTTCGTGCAAGCCTTGCAAGCCTGCACCCAAGTGTAAATGAAAGCCGCATCGAAAGCCACATCTAAGCCACATCTAAGCCAAAGCCAAACCAAAGGCGTGTGATTCAGGCAAGAAGAAGAACACCACCAAGAAACCGCGGAAACCGCGGAAGACTCAGCCACAA

Full Affymetrix probeset data:

Annotations for 1626630_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720