FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626633_at:

>probe:Drosophila_2:1626633_at:470:489; Interrogation_Position=110; Antisense; GTACTGTCCCACAGAATTCCCAGAA
>probe:Drosophila_2:1626633_at:517:383; Interrogation_Position=132; Antisense; GAACTCGCAGAACTCAACGCCAAAT
>probe:Drosophila_2:1626633_at:315:523; Interrogation_Position=252; Antisense; GGGCGAACGGGATGATGCACCCACT
>probe:Drosophila_2:1626633_at:212:277; Interrogation_Position=26; Antisense; CTTTGCGGGCAATTAGCGACGAGGT
>probe:Drosophila_2:1626633_at:54:697; Interrogation_Position=359; Antisense; TTTCTGGGACTGGATCGGGTGCATC
>probe:Drosophila_2:1626633_at:404:579; Interrogation_Position=393; Antisense; GGCCACGGGCAGGACTGTGAATCTT
>probe:Drosophila_2:1626633_at:554:463; Interrogation_Position=420; Antisense; GATTCGTTGTATCTGTCATCACATT
>probe:Drosophila_2:1626633_at:634:599; Interrogation_Position=433; Antisense; TGTCATCACATTACTGCCCAAGAGG
>probe:Drosophila_2:1626633_at:219:239; Interrogation_Position=518; Antisense; AATCATCACTGGATTGGTCGGCCAG
>probe:Drosophila_2:1626633_at:699:577; Interrogation_Position=537; Antisense; GGCCAGTTGGGCAGTTCGTCAGTTC
>probe:Drosophila_2:1626633_at:94:289; Interrogation_Position=561; Antisense; CGGCCATTCCGCTTTGAAGTCAATT
>probe:Drosophila_2:1626633_at:335:371; Interrogation_Position=576; Antisense; GAAGTCAATTGTGTGGCGGCATAAT
>probe:Drosophila_2:1626633_at:698:363; Interrogation_Position=66; Antisense; GAATTCGACGACTCCGCAACAGAGG
>probe:Drosophila_2:1626633_at:160:101; Interrogation_Position=86; Antisense; AGAGGAAGATGCACTCCATGCCGCG

Paste this into a BLAST search page for me
GTACTGTCCCACAGAATTCCCAGAAGAACTCGCAGAACTCAACGCCAAATGGGCGAACGGGATGATGCACCCACTCTTTGCGGGCAATTAGCGACGAGGTTTTCTGGGACTGGATCGGGTGCATCGGCCACGGGCAGGACTGTGAATCTTGATTCGTTGTATCTGTCATCACATTTGTCATCACATTACTGCCCAAGAGGAATCATCACTGGATTGGTCGGCCAGGGCCAGTTGGGCAGTTCGTCAGTTCCGGCCATTCCGCTTTGAAGTCAATTGAAGTCAATTGTGTGGCGGCATAATGAATTCGACGACTCCGCAACAGAGGAGAGGAAGATGCACTCCATGCCGCG

Full Affymetrix probeset data:

Annotations for 1626633_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720