FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626635_at:

>probe:Drosophila_2:1626635_at:98:149; Interrogation_Position=388; Antisense; ACTATTAAATCTCGCTGGATGCCTG
>probe:Drosophila_2:1626635_at:698:447; Interrogation_Position=405; Antisense; GATGCCTGCGGCAATAGTTATTGTT
>probe:Drosophila_2:1626635_at:691:187; Interrogation_Position=467; Antisense; AACAGCACCGACAGGACCAACAGGA
>probe:Drosophila_2:1626635_at:555:259; Interrogation_Position=503; Antisense; CACGGGCGGCGAAACAAATTTGCAA
>probe:Drosophila_2:1626635_at:93:161; Interrogation_Position=531; Antisense; AAATTTATGCGGATTTTTGCGTCGC
>probe:Drosophila_2:1626635_at:63:407; Interrogation_Position=568; Antisense; GACGTCGACGTCATCGAACCGCGTA
>probe:Drosophila_2:1626635_at:462:487; Interrogation_Position=590; Antisense; GTAGCCCAGGCCATGCTGCTGACGT
>probe:Drosophila_2:1626635_at:196:287; Interrogation_Position=698; Antisense; CGGCGACGACGCGAGCAGTTATTAT
>probe:Drosophila_2:1626635_at:655:67; Interrogation_Position=727; Antisense; ATGGCGTTAGTTGTTAGCATAATGC
>probe:Drosophila_2:1626635_at:242:145; Interrogation_Position=771; Antisense; ACTCTGGCCATTCTGTAACGGTAAG
>probe:Drosophila_2:1626635_at:517:599; Interrogation_Position=784; Antisense; TGTAACGGTAAGTGCTCTAGCCCTC
>probe:Drosophila_2:1626635_at:676:113; Interrogation_Position=811; Antisense; AGCAGATCTGCCACTTTTTTGGCCT
>probe:Drosophila_2:1626635_at:666:699; Interrogation_Position=825; Antisense; TTTTTTGGCCTTTGACCTGGCTGCA
>probe:Drosophila_2:1626635_at:312:131; Interrogation_Position=839; Antisense; ACCTGGCTGCATTTTGGTTGGCCAA

Paste this into a BLAST search page for me
ACTATTAAATCTCGCTGGATGCCTGGATGCCTGCGGCAATAGTTATTGTTAACAGCACCGACAGGACCAACAGGACACGGGCGGCGAAACAAATTTGCAAAAATTTATGCGGATTTTTGCGTCGCGACGTCGACGTCATCGAACCGCGTAGTAGCCCAGGCCATGCTGCTGACGTCGGCGACGACGCGAGCAGTTATTATATGGCGTTAGTTGTTAGCATAATGCACTCTGGCCATTCTGTAACGGTAAGTGTAACGGTAAGTGCTCTAGCCCTCAGCAGATCTGCCACTTTTTTGGCCTTTTTTTGGCCTTTGACCTGGCTGCAACCTGGCTGCATTTTGGTTGGCCAA

Full Affymetrix probeset data:

Annotations for 1626635_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720