FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626638_at:

>probe:Drosophila_2:1626638_at:312:17; Interrogation_Position=1521; Antisense; ATTTTCAGTGTAATGTTTACCTTCA
>probe:Drosophila_2:1626638_at:376:85; Interrogation_Position=1527; Antisense; AGTGTAATGTTTACCTTCAATATTA
>probe:Drosophila_2:1626638_at:336:477; Interrogation_Position=1535; Antisense; GTTTACCTTCAATATTAAGTATGTT
>probe:Drosophila_2:1626638_at:616:217; Interrogation_Position=1551; Antisense; AAGTATGTTATTATGCGTAGCATTT
>probe:Drosophila_2:1626638_at:407:487; Interrogation_Position=1567; Antisense; GTAGCATTTATATACAATACTCATT
>probe:Drosophila_2:1626638_at:401:459; Interrogation_Position=1641; Antisense; GATATTTATTCTATTCTATTACTTT
>probe:Drosophila_2:1626638_at:137:709; Interrogation_Position=1667; Antisense; TTAATGATCAAATAGCTTCGCAAAT
>probe:Drosophila_2:1626638_at:78:27; Interrogation_Position=1678; Antisense; ATAGCTTCGCAAATATTATCATCTT
>probe:Drosophila_2:1626638_at:661:343; Interrogation_Position=1681; Antisense; GCTTCGCAAATATTATCATCTTATG
>probe:Drosophila_2:1626638_at:640:37; Interrogation_Position=1698; Antisense; ATCTTATGTTGTGTGAATGGCGTGG
>probe:Drosophila_2:1626638_at:640:227; Interrogation_Position=1713; Antisense; AATGGCGTGGGCTCTATCTTTAATG
>probe:Drosophila_2:1626638_at:654:329; Interrogation_Position=1717; Antisense; GCGTGGGCTCTATCTTTAATGTTTA
>probe:Drosophila_2:1626638_at:108:525; Interrogation_Position=1721; Antisense; GGGCTCTATCTTTAATGTTTATATT
>probe:Drosophila_2:1626638_at:638:695; Interrogation_Position=1745; Antisense; TTTAACTAACTAACTTGTACACAAT

Paste this into a BLAST search page for me
ATTTTCAGTGTAATGTTTACCTTCAAGTGTAATGTTTACCTTCAATATTAGTTTACCTTCAATATTAAGTATGTTAAGTATGTTATTATGCGTAGCATTTGTAGCATTTATATACAATACTCATTGATATTTATTCTATTCTATTACTTTTTAATGATCAAATAGCTTCGCAAATATAGCTTCGCAAATATTATCATCTTGCTTCGCAAATATTATCATCTTATGATCTTATGTTGTGTGAATGGCGTGGAATGGCGTGGGCTCTATCTTTAATGGCGTGGGCTCTATCTTTAATGTTTAGGGCTCTATCTTTAATGTTTATATTTTTAACTAACTAACTTGTACACAAT

Full Affymetrix probeset data:

Annotations for 1626638_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720