FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626640_at:

>probe:Drosophila_2:1626640_at:203:573; Interrogation_Position=126; Antisense; GGCGGACGAGTACAATTCTGTTCTT
>probe:Drosophila_2:1626640_at:708:721; Interrogation_Position=151; Antisense; TTGAACCCCTGTCACTGCAAAGGAG
>probe:Drosophila_2:1626640_at:624:373; Interrogation_Position=190; Antisense; GAAGTCTGTGCACATGGAGGCCAAT
>probe:Drosophila_2:1626640_at:605:565; Interrogation_Position=251; Antisense; GGAATTCCGCAAATCCTGTCATTGA
>probe:Drosophila_2:1626640_at:263:675; Interrogation_Position=300; Antisense; TAGAAACACGTGCTCCAATCGGCTT
>probe:Drosophila_2:1626640_at:354:343; Interrogation_Position=321; Antisense; GCTTGTGTACTCAGGCCCGAGGAAA
>probe:Drosophila_2:1626640_at:406:19; Interrogation_Position=347; Antisense; ATTTGGAAATATTCGATTCGCCCGT
>probe:Drosophila_2:1626640_at:419:319; Interrogation_Position=366; Antisense; GCCCGTGTACGGATCCAAAGGACTA
>probe:Drosophila_2:1626640_at:631:455; Interrogation_Position=419; Antisense; GATACATTTGCGAATATGCCGGAGA
>probe:Drosophila_2:1626640_at:302:493; Interrogation_Position=449; Antisense; TAACGGTTCCCGAGGCAAGAAGCCG
>probe:Drosophila_2:1626640_at:163:579; Interrogation_Position=496; Antisense; GGCCTGATGAACTATATCCTGGTGC
>probe:Drosophila_2:1626640_at:626:519; Interrogation_Position=578; Antisense; GTGGAAACATCGGACGCTACCTGAA
>probe:Drosophila_2:1626640_at:692:117; Interrogation_Position=607; Antisense; AGCTGCGAACCGAACTGTCATATAG
>probe:Drosophila_2:1626640_at:140:121; Interrogation_Position=633; Antisense; AGCTGTACGAATAGACTGTCCCATA

Paste this into a BLAST search page for me
GGCGGACGAGTACAATTCTGTTCTTTTGAACCCCTGTCACTGCAAAGGAGGAAGTCTGTGCACATGGAGGCCAATGGAATTCCGCAAATCCTGTCATTGATAGAAACACGTGCTCCAATCGGCTTGCTTGTGTACTCAGGCCCGAGGAAAATTTGGAAATATTCGATTCGCCCGTGCCCGTGTACGGATCCAAAGGACTAGATACATTTGCGAATATGCCGGAGATAACGGTTCCCGAGGCAAGAAGCCGGGCCTGATGAACTATATCCTGGTGCGTGGAAACATCGGACGCTACCTGAAAGCTGCGAACCGAACTGTCATATAGAGCTGTACGAATAGACTGTCCCATA

Full Affymetrix probeset data:

Annotations for 1626640_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720