Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626641_s_at:

>probe:Drosophila_2:1626641_s_at:135:185; Interrogation_Position=427; Antisense; AAAATTGCCGTTAGTCACATTCCGC
>probe:Drosophila_2:1626641_s_at:700:631; Interrogation_Position=447; Antisense; TCCGCGGACCGTTTCCAAGGAGTCT
>probe:Drosophila_2:1626641_s_at:212:705; Interrogation_Position=491; Antisense; TTATCCTGGATGTGCTGACAGCTGC
>probe:Drosophila_2:1626641_s_at:24:121; Interrogation_Position=554; Antisense; AGCTGGTGGACCATGTCTACGGAAT
>probe:Drosophila_2:1626641_s_at:704:497; Interrogation_Position=568; Antisense; GTCTACGGAATCATCTTCAAGGCGA
>probe:Drosophila_2:1626641_s_at:706:35; Interrogation_Position=580; Antisense; ATCTTCAAGGCGATCGACGACGACG
>probe:Drosophila_2:1626641_s_at:413:445; Interrogation_Position=639; Antisense; GATGCAACCGAATCCGCGGAAGGAT
>probe:Drosophila_2:1626641_s_at:217:225; Interrogation_Position=658; Antisense; AAGGATGCAACTGATGCCAGCCGGT
>probe:Drosophila_2:1626641_s_at:368:567; Interrogation_Position=683; Antisense; GGCACTTGCAACACATGCACAGCTT
>probe:Drosophila_2:1626641_s_at:83:231; Interrogation_Position=730; Antisense; AATGTTAGCTATTCTCGTTTTGTAA
>probe:Drosophila_2:1626641_s_at:530:147; Interrogation_Position=799; Antisense; ACTTATGTCTGCGTAGAGCTACTGA
>probe:Drosophila_2:1626641_s_at:203:355; Interrogation_Position=854; Antisense; GCACTTGCATTGCTCTGTAAAGCTT
>probe:Drosophila_2:1626641_s_at:618:207; Interrogation_Position=873; Antisense; AAGCTTTAACCCATTGTCAGCCTTA
>probe:Drosophila_2:1626641_s_at:82:497; Interrogation_Position=888; Antisense; GTCAGCCTTAAGCACTTGATAGCAA

Paste this into a BLAST search page for me
AAAATTGCCGTTAGTCACATTCCGCTCCGCGGACCGTTTCCAAGGAGTCTTTATCCTGGATGTGCTGACAGCTGCAGCTGGTGGACCATGTCTACGGAATGTCTACGGAATCATCTTCAAGGCGAATCTTCAAGGCGATCGACGACGACGGATGCAACCGAATCCGCGGAAGGATAAGGATGCAACTGATGCCAGCCGGTGGCACTTGCAACACATGCACAGCTTAATGTTAGCTATTCTCGTTTTGTAAACTTATGTCTGCGTAGAGCTACTGAGCACTTGCATTGCTCTGTAAAGCTTAAGCTTTAACCCATTGTCAGCCTTAGTCAGCCTTAAGCACTTGATAGCAA

Full Affymetrix probeset data:

Annotations for 1626641_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime