FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626642_at:

>probe:Drosophila_2:1626642_at:547:499; Interrogation_Position=1030; Antisense; GTCTGAGCGGTGATCTGGTCGTCTA
>probe:Drosophila_2:1626642_at:391:641; Interrogation_Position=457; Antisense; TCTCGGGCAGCTGGGATTGTACACT
>probe:Drosophila_2:1626642_at:558:107; Interrogation_Position=505; Antisense; AGAACTCCATCACCACATTTGTGGG
>probe:Drosophila_2:1626642_at:705:595; Interrogation_Position=524; Antisense; TGTGGGCCACAACGATCTGATCTAC
>probe:Drosophila_2:1626642_at:47:307; Interrogation_Position=566; Antisense; CCTGATCGCCAATCTGTTTGCAAGC
>probe:Drosophila_2:1626642_at:5:563; Interrogation_Position=619; Antisense; GGAACTCTCTTGACTTTGCAGGTAA
>probe:Drosophila_2:1626642_at:225:77; Interrogation_Position=638; Antisense; AGGTAAACCCCTGATGAGCATCGAG
>probe:Drosophila_2:1626642_at:226:513; Interrogation_Position=673; Antisense; GTGAGGCACTATGCTGCGACTGGTC
>probe:Drosophila_2:1626642_at:201:407; Interrogation_Position=690; Antisense; GACTGGTCGCACTTCGATCGCAATG
>probe:Drosophila_2:1626642_at:210:451; Interrogation_Position=705; Antisense; GATCGCAATGTCCTGGTCACTGGAG
>probe:Drosophila_2:1626642_at:309:75; Interrogation_Position=771; Antisense; AGGACGCACGTCTTTGAGCTGTACT
>probe:Drosophila_2:1626642_at:405:669; Interrogation_Position=792; Antisense; TACTCTGGAGAATTCGCTGTCCGGC
>probe:Drosophila_2:1626642_at:188:513; Interrogation_Position=901; Antisense; GTGAGTCCGCCCAGGAGGTCAATGC
>probe:Drosophila_2:1626642_at:151:75; Interrogation_Position=969; Antisense; AGGACCCATCAGTTGGCCGACTGTG

Paste this into a BLAST search page for me
GTCTGAGCGGTGATCTGGTCGTCTATCTCGGGCAGCTGGGATTGTACACTAGAACTCCATCACCACATTTGTGGGTGTGGGCCACAACGATCTGATCTACCCTGATCGCCAATCTGTTTGCAAGCGGAACTCTCTTGACTTTGCAGGTAAAGGTAAACCCCTGATGAGCATCGAGGTGAGGCACTATGCTGCGACTGGTCGACTGGTCGCACTTCGATCGCAATGGATCGCAATGTCCTGGTCACTGGAGAGGACGCACGTCTTTGAGCTGTACTTACTCTGGAGAATTCGCTGTCCGGCGTGAGTCCGCCCAGGAGGTCAATGCAGGACCCATCAGTTGGCCGACTGTG

Full Affymetrix probeset data:

Annotations for 1626642_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720