FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626643_at:

>probe:Drosophila_2:1626643_at:497:177; Interrogation_Position=1552; Antisense; AAACTCGGATCGATTGCCTGTTATC
>probe:Drosophila_2:1626643_at:107:477; Interrogation_Position=1571; Antisense; GTTATCGCCACCGTTTAGCACCAAA
>probe:Drosophila_2:1626643_at:497:109; Interrogation_Position=1587; Antisense; AGCACCAAACTCAATTTCGCTTTTA
>probe:Drosophila_2:1626643_at:32:419; Interrogation_Position=1625; Antisense; GAGCTGATCTCAACTTAAACGTAAT
>probe:Drosophila_2:1626643_at:291:319; Interrogation_Position=1662; Antisense; GCCGCGCTTAAAGATCACTTACTCG
>probe:Drosophila_2:1626643_at:569:73; Interrogation_Position=1694; Antisense; AGGAACACTTGTTGACAGTCTTTAA
>probe:Drosophila_2:1626643_at:214:709; Interrogation_Position=1715; Antisense; TTAAGCGTCATTACTCTTTCGTCGT
>probe:Drosophila_2:1626643_at:584:639; Interrogation_Position=1729; Antisense; TCTTTCGTCGTGTTCTTACCTTAAT
>probe:Drosophila_2:1626643_at:410:475; Interrogation_Position=1766; Antisense; GTTAGTATTTCCGAGTCTTTCAATA
>probe:Drosophila_2:1626643_at:551:725; Interrogation_Position=1798; Antisense; TTGATCGGCCATTGTACTTTTGTGA
>probe:Drosophila_2:1626643_at:704:603; Interrogation_Position=1820; Antisense; TGATTTTCATACACGTTACTGGCTG
>probe:Drosophila_2:1626643_at:620:125; Interrogation_Position=1832; Antisense; ACGTTACTGGCTGAAAGGTCGGCTT
>probe:Drosophila_2:1626643_at:410:77; Interrogation_Position=1847; Antisense; AGGTCGGCTTAGATCACACGGAAAA
>probe:Drosophila_2:1626643_at:56:153; Interrogation_Position=2062; Antisense; ACAAAGCCCCTGTATTATGTCGTTT

Paste this into a BLAST search page for me
AAACTCGGATCGATTGCCTGTTATCGTTATCGCCACCGTTTAGCACCAAAAGCACCAAACTCAATTTCGCTTTTAGAGCTGATCTCAACTTAAACGTAATGCCGCGCTTAAAGATCACTTACTCGAGGAACACTTGTTGACAGTCTTTAATTAAGCGTCATTACTCTTTCGTCGTTCTTTCGTCGTGTTCTTACCTTAATGTTAGTATTTCCGAGTCTTTCAATATTGATCGGCCATTGTACTTTTGTGATGATTTTCATACACGTTACTGGCTGACGTTACTGGCTGAAAGGTCGGCTTAGGTCGGCTTAGATCACACGGAAAAACAAAGCCCCTGTATTATGTCGTTT

Full Affymetrix probeset data:

Annotations for 1626643_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720