FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626644_at:

>probe:Drosophila_2:1626644_at:36:183; Interrogation_Position=119; Antisense; AAAACCAAAAACCAGCCGCAGAGCA
>probe:Drosophila_2:1626644_at:651:299; Interrogation_Position=151; Antisense; CGCGACCGCCGAAACATTTCAAAGA
>probe:Drosophila_2:1626644_at:417:65; Interrogation_Position=278; Antisense; ATGGATCAACTCAAACTCAGACCTT
>probe:Drosophila_2:1626644_at:250:133; Interrogation_Position=291; Antisense; AACTCAGACCTTGTAACTGCCTGAC
>probe:Drosophila_2:1626644_at:728:609; Interrogation_Position=312; Antisense; TGACCGCACATCCACTGGCAGAGTG
>probe:Drosophila_2:1626644_at:653:369; Interrogation_Position=347; Antisense; GAATGTGAGCGGCTGTGCACCCTTC
>probe:Drosophila_2:1626644_at:132:639; Interrogation_Position=370; Antisense; TCGTCTTGCCAGTTTTCGAAAAGGG
>probe:Drosophila_2:1626644_at:547:421; Interrogation_Position=445; Antisense; GAGCAAACGGTTTCGGCATTTCCCT
>probe:Drosophila_2:1626644_at:592:345; Interrogation_Position=483; Antisense; GCATCCTTTGGCCAAGACACGGACA
>probe:Drosophila_2:1626644_at:376:693; Interrogation_Position=559; Antisense; TTTGCTTATCTTTTCATCTCTCTGT
>probe:Drosophila_2:1626644_at:27:481; Interrogation_Position=593; Antisense; GTTTGCTGCACGATTCGTTGTTGCT
>probe:Drosophila_2:1626644_at:219:335; Interrogation_Position=615; Antisense; GCTGCTGTTGGCCATCCAGAAAATC
>probe:Drosophila_2:1626644_at:168:229; Interrogation_Position=71; Antisense; AATGGACCGTTAAAGCCCAGCTCTG
>probe:Drosophila_2:1626644_at:458:723; Interrogation_Position=97; Antisense; TTGCTGATGCCTGCGTGTATCGAAA

Paste this into a BLAST search page for me
AAAACCAAAAACCAGCCGCAGAGCACGCGACCGCCGAAACATTTCAAAGAATGGATCAACTCAAACTCAGACCTTAACTCAGACCTTGTAACTGCCTGACTGACCGCACATCCACTGGCAGAGTGGAATGTGAGCGGCTGTGCACCCTTCTCGTCTTGCCAGTTTTCGAAAAGGGGAGCAAACGGTTTCGGCATTTCCCTGCATCCTTTGGCCAAGACACGGACATTTGCTTATCTTTTCATCTCTCTGTGTTTGCTGCACGATTCGTTGTTGCTGCTGCTGTTGGCCATCCAGAAAATCAATGGACCGTTAAAGCCCAGCTCTGTTGCTGATGCCTGCGTGTATCGAAA

Full Affymetrix probeset data:

Annotations for 1626644_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720