FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626645_at:

>probe:Drosophila_2:1626645_at:595:315; Interrogation_Position=1268; Antisense; GCCTTGACCTTAACGCAGTTCATCA
>probe:Drosophila_2:1626645_at:147:5; Interrogation_Position=1292; Antisense; ATTGGATTTGCCTTCACATCGATAG
>probe:Drosophila_2:1626645_at:508:531; Interrogation_Position=1329; Antisense; GGGTGACTCTCATCCAGACCATATT
>probe:Drosophila_2:1626645_at:538:11; Interrogation_Position=1351; Antisense; ATTCTCCAAAGTTCTGGGACCTCGG
>probe:Drosophila_2:1626645_at:619:729; Interrogation_Position=1431; Antisense; TTGGTCCAGTCTTCGTGGGATCCAT
>probe:Drosophila_2:1626645_at:31:667; Interrogation_Position=1457; Antisense; TACACGCGCCTAGGTACGTTCTGGA
>probe:Drosophila_2:1626645_at:33:53; Interrogation_Position=1505; Antisense; ATGCTGGTCTCCATGTTTTGGCTAC
>probe:Drosophila_2:1626645_at:603:279; Interrogation_Position=1547; Antisense; CTAATCCCGCCAACATTCGAAAAGA
>probe:Drosophila_2:1626645_at:77:389; Interrogation_Position=1565; Antisense; GAAAAGACCACACCTGTCGAGCTGA
>probe:Drosophila_2:1626645_at:555:227; Interrogation_Position=1649; Antisense; AATGGTAGCCCACCGGAAGATCTGT
>probe:Drosophila_2:1626645_at:82:17; Interrogation_Position=1688; Antisense; ATTTTGGGCAAGCACGGCAGCCAGC
>probe:Drosophila_2:1626645_at:425:309; Interrogation_Position=1708; Antisense; CCAGCACTCGATTTCACATGCGTAA
>probe:Drosophila_2:1626645_at:424:199; Interrogation_Position=1731; Antisense; AACGACGGCTGGCTATGGAGCATCC
>probe:Drosophila_2:1626645_at:117:359; Interrogation_Position=1777; Antisense; GCAATACTGCCCCTTAAACTAGCTT

Paste this into a BLAST search page for me
GCCTTGACCTTAACGCAGTTCATCAATTGGATTTGCCTTCACATCGATAGGGGTGACTCTCATCCAGACCATATTATTCTCCAAAGTTCTGGGACCTCGGTTGGTCCAGTCTTCGTGGGATCCATTACACGCGCCTAGGTACGTTCTGGAATGCTGGTCTCCATGTTTTGGCTACCTAATCCCGCCAACATTCGAAAAGAGAAAAGACCACACCTGTCGAGCTGAAATGGTAGCCCACCGGAAGATCTGTATTTTGGGCAAGCACGGCAGCCAGCCCAGCACTCGATTTCACATGCGTAAAACGACGGCTGGCTATGGAGCATCCGCAATACTGCCCCTTAAACTAGCTT

Full Affymetrix probeset data:

Annotations for 1626645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720