FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626647_at:

>probe:Drosophila_2:1626647_at:487:171; Interrogation_Position=1892; Antisense; AAAGAGCCGCTACGTGCTTATGCGC
>probe:Drosophila_2:1626647_at:472:705; Interrogation_Position=1909; Antisense; TTATGCGCAGTGGAGCCGGCCAGCA
>probe:Drosophila_2:1626647_at:132:227; Interrogation_Position=1938; Antisense; AAGGCATCTGACAAGCGGCTAAGCA
>probe:Drosophila_2:1626647_at:533:143; Interrogation_Position=1971; Antisense; ACTGTGCGTCAGTTGGAGGCTGTCA
>probe:Drosophila_2:1626647_at:666:693; Interrogation_Position=2002; Antisense; TTTCGGAGTCGCTGGCAAAGATTCG
>probe:Drosophila_2:1626647_at:337:185; Interrogation_Position=2019; Antisense; AAGATTCGTTTGCAACCGTTCGCCA
>probe:Drosophila_2:1626647_at:51:137; Interrogation_Position=2059; Antisense; ACGAAGCACTTCGACTTTTCCAAGT
>probe:Drosophila_2:1626647_at:523:221; Interrogation_Position=2080; Antisense; AAGTGTCTACCCTTGATGCTGCGAT
>probe:Drosophila_2:1626647_at:1:417; Interrogation_Position=2122; Antisense; GAGCCGAAGGATTCACGACCGAGGA
>probe:Drosophila_2:1626647_at:26:75; Interrogation_Position=2152; Antisense; AGGAAACACTCAACCGCATCGAAAA
>probe:Drosophila_2:1626647_at:466:389; Interrogation_Position=2183; Antisense; GAAACGTCGCTTTGCAATTGGATCT
>probe:Drosophila_2:1626647_at:690:245; Interrogation_Position=2279; Antisense; AATTCATACCATGATCCGACGTGGA
>probe:Drosophila_2:1626647_at:42:447; Interrogation_Position=2330; Antisense; GATGCTCTATCGAATTTGCTAAACA
>probe:Drosophila_2:1626647_at:280:655; Interrogation_Position=2359; Antisense; TAATCACTTCATTTCTTGTCCATCG

Paste this into a BLAST search page for me
AAAGAGCCGCTACGTGCTTATGCGCTTATGCGCAGTGGAGCCGGCCAGCAAAGGCATCTGACAAGCGGCTAAGCAACTGTGCGTCAGTTGGAGGCTGTCATTTCGGAGTCGCTGGCAAAGATTCGAAGATTCGTTTGCAACCGTTCGCCAACGAAGCACTTCGACTTTTCCAAGTAAGTGTCTACCCTTGATGCTGCGATGAGCCGAAGGATTCACGACCGAGGAAGGAAACACTCAACCGCATCGAAAAGAAACGTCGCTTTGCAATTGGATCTAATTCATACCATGATCCGACGTGGAGATGCTCTATCGAATTTGCTAAACATAATCACTTCATTTCTTGTCCATCG

Full Affymetrix probeset data:

Annotations for 1626647_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720