FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626648_at:

>probe:Drosophila_2:1626648_at:448:329; Interrogation_Position=122; Antisense; GCGGCTATCTGCTGACGGGCACAAG
>probe:Drosophila_2:1626648_at:399:219; Interrogation_Position=144; Antisense; AAGTGCGCCGCGTGACGATGAGTTC
>probe:Drosophila_2:1626648_at:359:471; Interrogation_Position=165; Antisense; GTTCGTCGCAGGACGGAGGCATCTT
>probe:Drosophila_2:1626648_at:308:549; Interrogation_Position=179; Antisense; GGAGGCATCTTCTGGATCAGGGCAA
>probe:Drosophila_2:1626648_at:372:463; Interrogation_Position=19; Antisense; GATTCGGGATCGATACACCTGCACG
>probe:Drosophila_2:1626648_at:314:671; Interrogation_Position=244; Antisense; TACGCACCTGCCGATGAGTGCTTAA
>probe:Drosophila_2:1626648_at:155:439; Interrogation_Position=316; Antisense; GAGGCAGTGGCCAAGACCATCACCG
>probe:Drosophila_2:1626648_at:137:133; Interrogation_Position=337; Antisense; ACCGAGCTGAGAGTGCCCACCATAA
>probe:Drosophila_2:1626648_at:646:241; Interrogation_Position=451; Antisense; AATAGCAACATGTCGCGCCTTATAC
>probe:Drosophila_2:1626648_at:549:199; Interrogation_Position=476; Antisense; AACCGCGATATCGTTTTCGGGATCT
>probe:Drosophila_2:1626648_at:76:597; Interrogation_Position=48; Antisense; TGTCGCGAGCCCGTTAAGGACACTC
>probe:Drosophila_2:1626648_at:591:639; Interrogation_Position=492; Antisense; TCGGGATCTATTACTGGGCGATTTC
>probe:Drosophila_2:1626648_at:452:523; Interrogation_Position=507; Antisense; GGGCGATTTCTCATTTAACGACGAC
>probe:Drosophila_2:1626648_at:539:225; Interrogation_Position=63; Antisense; AAGGACACTCGCCAATCTGTGGACG

Paste this into a BLAST search page for me
GCGGCTATCTGCTGACGGGCACAAGAAGTGCGCCGCGTGACGATGAGTTCGTTCGTCGCAGGACGGAGGCATCTTGGAGGCATCTTCTGGATCAGGGCAAGATTCGGGATCGATACACCTGCACGTACGCACCTGCCGATGAGTGCTTAAGAGGCAGTGGCCAAGACCATCACCGACCGAGCTGAGAGTGCCCACCATAAAATAGCAACATGTCGCGCCTTATACAACCGCGATATCGTTTTCGGGATCTTGTCGCGAGCCCGTTAAGGACACTCTCGGGATCTATTACTGGGCGATTTCGGGCGATTTCTCATTTAACGACGACAAGGACACTCGCCAATCTGTGGACG

Full Affymetrix probeset data:

Annotations for 1626648_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720