FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626650_at:

>probe:Drosophila_2:1626650_at:541:107; Interrogation_Position=1556; Antisense; AGAACAAGTGCTCCGCGAGGGCCAT
>probe:Drosophila_2:1626650_at:392:433; Interrogation_Position=1572; Antisense; GAGGGCCATCACCAAGTTCGACGGA
>probe:Drosophila_2:1626650_at:596:251; Interrogation_Position=1584; Antisense; CAAGTTCGACGGAGGGATCAAGCTG
>probe:Drosophila_2:1626650_at:82:527; Interrogation_Position=1609; Antisense; GGGAAGAATGCCCACAATCATCCGC
>probe:Drosophila_2:1626650_at:378:45; Interrogation_Position=1628; Antisense; ATCCGCCGCGCTTTTTGGGTGGCAA
>probe:Drosophila_2:1626650_at:451:625; Interrogation_Position=1655; Antisense; TGCCCGCTAAACTAATGCCCAAGGA
>probe:Drosophila_2:1626650_at:295:321; Interrogation_Position=1671; Antisense; GCCCAAGGATGCTTTTTATCCGCAA
>probe:Drosophila_2:1626650_at:64:657; Interrogation_Position=1713; Antisense; TAAACCCGAAAGAATGTCATTTGTC
>probe:Drosophila_2:1626650_at:550:461; Interrogation_Position=1743; Antisense; GATTATACCCAGTTGCATGCATTAC
>probe:Drosophila_2:1626650_at:247:269; Interrogation_Position=1758; Antisense; CATGCATTACCTACCATAAGCTCAT
>probe:Drosophila_2:1626650_at:418:659; Interrogation_Position=1774; Antisense; TAAGCTCATTAAACTCATGTGGCAG
>probe:Drosophila_2:1626650_at:437:521; Interrogation_Position=1792; Antisense; GTGGCAGCAGTCATTTCATCATCAT
>probe:Drosophila_2:1626650_at:392:37; Interrogation_Position=1809; Antisense; ATCATCATACCATCTTCATCTTCGT
>probe:Drosophila_2:1626650_at:198:713; Interrogation_Position=1835; Antisense; TTCATCCTCTTCAGCAAAAGACCAG

Paste this into a BLAST search page for me
AGAACAAGTGCTCCGCGAGGGCCATGAGGGCCATCACCAAGTTCGACGGACAAGTTCGACGGAGGGATCAAGCTGGGGAAGAATGCCCACAATCATCCGCATCCGCCGCGCTTTTTGGGTGGCAATGCCCGCTAAACTAATGCCCAAGGAGCCCAAGGATGCTTTTTATCCGCAATAAACCCGAAAGAATGTCATTTGTCGATTATACCCAGTTGCATGCATTACCATGCATTACCTACCATAAGCTCATTAAGCTCATTAAACTCATGTGGCAGGTGGCAGCAGTCATTTCATCATCATATCATCATACCATCTTCATCTTCGTTTCATCCTCTTCAGCAAAAGACCAG

Full Affymetrix probeset data:

Annotations for 1626650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720