FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626651_at:

>probe:Drosophila_2:1626651_at:685:167; Interrogation_Position=132; Antisense; AAATGTTTCCTGCAAAGCTGGGTCC
>probe:Drosophila_2:1626651_at:472:503; Interrogation_Position=153; Antisense; GTCCCAATTTGATGACAGCCTCCAA
>probe:Drosophila_2:1626651_at:534:661; Interrogation_Position=183; Antisense; TAAAAAGTCCTCTTGGCCAGGCGTT
>probe:Drosophila_2:1626651_at:235:707; Interrogation_Position=206; Antisense; TTAGTCTCCTTTTTGGTTGGCTACT
>probe:Drosophila_2:1626651_at:718:589; Interrogation_Position=219; Antisense; TGGTTGGCTACTTTGTCACCACAAA
>probe:Drosophila_2:1626651_at:616:489; Interrogation_Position=304; Antisense; GTACTTGGACATGTACCCCAGGAAA
>probe:Drosophila_2:1626651_at:618:137; Interrogation_Position=357; Antisense; ACGATATCGTTCTGCTCACTCTGGA
>probe:Drosophila_2:1626651_at:399:549; Interrogation_Position=379; Antisense; GGAGGAGCTAACTGCCTTCGATGGC
>probe:Drosophila_2:1626651_at:184:21; Interrogation_Position=446; Antisense; ATATACGATCTGAGTCCGGGCCGAG
>probe:Drosophila_2:1626651_at:505:387; Interrogation_Position=470; Antisense; GAAAAGTTCAGCAGTCACGGTCCGT
>probe:Drosophila_2:1626651_at:729:487; Interrogation_Position=493; Antisense; GTACTCCCTATTGGCCGGTTGCAAT
>probe:Drosophila_2:1626651_at:265:223; Interrogation_Position=524; Antisense; AAGGTCCTGAACATTGCCTGCAGTT
>probe:Drosophila_2:1626651_at:345:575; Interrogation_Position=554; Antisense; GGCGTCTGCGCTGCGAACGTAATAA
>probe:Drosophila_2:1626651_at:18:421; Interrogation_Position=587; Antisense; GAGCAGAGCCTAAGAGCCGAATTTA

Paste this into a BLAST search page for me
AAATGTTTCCTGCAAAGCTGGGTCCGTCCCAATTTGATGACAGCCTCCAATAAAAAGTCCTCTTGGCCAGGCGTTTTAGTCTCCTTTTTGGTTGGCTACTTGGTTGGCTACTTTGTCACCACAAAGTACTTGGACATGTACCCCAGGAAAACGATATCGTTCTGCTCACTCTGGAGGAGGAGCTAACTGCCTTCGATGGCATATACGATCTGAGTCCGGGCCGAGGAAAAGTTCAGCAGTCACGGTCCGTGTACTCCCTATTGGCCGGTTGCAATAAGGTCCTGAACATTGCCTGCAGTTGGCGTCTGCGCTGCGAACGTAATAAGAGCAGAGCCTAAGAGCCGAATTTA

Full Affymetrix probeset data:

Annotations for 1626651_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720