FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626652_at:

>probe:Drosophila_2:1626652_at:463:347; Interrogation_Position=2603; Antisense; GCAGGCCATTAGGAACTGTTCGCGG
>probe:Drosophila_2:1626652_at:265:553; Interrogation_Position=2630; Antisense; GGAGCAGATCTTCTTGCAGGCAATT
>probe:Drosophila_2:1626652_at:622:617; Interrogation_Position=2654; Antisense; TGCAGCTGAAGTTACGCGCACTGGC
>probe:Drosophila_2:1626652_at:480:409; Interrogation_Position=2687; Antisense; GACGACTTTCATGGGCGTCTATCAG
>probe:Drosophila_2:1626652_at:529:81; Interrogation_Position=2713; Antisense; AGGTGGAAACTATTGCCGCCTTCAT
>probe:Drosophila_2:1626652_at:594:317; Interrogation_Position=2793; Antisense; GCCGAGCGACTCATCATCAGTGAAC
>probe:Drosophila_2:1626652_at:189:35; Interrogation_Position=2805; Antisense; ATCATCAGTGAACATTCCCGCAATG
>probe:Drosophila_2:1626652_at:119:633; Interrogation_Position=2820; Antisense; TCCCGCAATGACCTCTTTCAGAAAA
>probe:Drosophila_2:1626652_at:455:107; Interrogation_Position=2839; Antisense; AGAAAATCCTGCTCAACGTCAGCGC
>probe:Drosophila_2:1626652_at:226:137; Interrogation_Position=2854; Antisense; ACGTCAGCGCTGATGACATTCACTA
>probe:Drosophila_2:1626652_at:56:13; Interrogation_Position=2871; Antisense; ATTCACTACGCCCTCAGAGTGGAAG
>probe:Drosophila_2:1626652_at:683:209; Interrogation_Position=2976; Antisense; AAGACTCCAAATCCAGGTTACTTGA
>probe:Drosophila_2:1626652_at:209:541; Interrogation_Position=2991; Antisense; GGTTACTTGACCTATCACATTTCCA
>probe:Drosophila_2:1626652_at:296:307; Interrogation_Position=3001; Antisense; CCTATCACATTTCCACCATTTTTAA

Paste this into a BLAST search page for me
GCAGGCCATTAGGAACTGTTCGCGGGGAGCAGATCTTCTTGCAGGCAATTTGCAGCTGAAGTTACGCGCACTGGCGACGACTTTCATGGGCGTCTATCAGAGGTGGAAACTATTGCCGCCTTCATGCCGAGCGACTCATCATCAGTGAACATCATCAGTGAACATTCCCGCAATGTCCCGCAATGACCTCTTTCAGAAAAAGAAAATCCTGCTCAACGTCAGCGCACGTCAGCGCTGATGACATTCACTAATTCACTACGCCCTCAGAGTGGAAGAAGACTCCAAATCCAGGTTACTTGAGGTTACTTGACCTATCACATTTCCACCTATCACATTTCCACCATTTTTAA

Full Affymetrix probeset data:

Annotations for 1626652_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720