Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626655_at:

>probe:Drosophila_2:1626655_at:352:547; Interrogation_Position=1010; Antisense; GGAGGACCTCAGTCTAGTGGTTCCC
>probe:Drosophila_2:1626655_at:567:677; Interrogation_Position=1024; Antisense; TAGTGGTTCCCGTGAGATTGCGCAT
>probe:Drosophila_2:1626655_at:681:607; Interrogation_Position=1036; Antisense; TGAGATTGCGCATCGCGGAGTACGA
>probe:Drosophila_2:1626655_at:699:487; Interrogation_Position=1055; Antisense; GTACGAGCAGCGCATCTCGATGAGT
>probe:Drosophila_2:1626655_at:21:283; Interrogation_Position=1070; Antisense; CTCGATGAGTGCTTAGGTCCAGAAA
>probe:Drosophila_2:1626655_at:234:231; Interrogation_Position=1205; Antisense; AATGTAAGCGTCTTGTTCTTGGCAA
>probe:Drosophila_2:1626655_at:355:175; Interrogation_Position=1260; Antisense; AAACCATTACTCCTTTGCAATCGGT
>probe:Drosophila_2:1626655_at:51:459; Interrogation_Position=1308; Antisense; GATATTCTATTTCTGACCAAACCCT
>probe:Drosophila_2:1626655_at:560:361; Interrogation_Position=1435; Antisense; GAATTGCTAAATCCACACACTACCA
>probe:Drosophila_2:1626655_at:468:491; Interrogation_Position=1466; Antisense; GTAAACTGAATCACGCAAGACTCCG
>probe:Drosophila_2:1626655_at:109:517; Interrogation_Position=1508; Antisense; GTGTCCACACCTATATTCGTGTGCA
>probe:Drosophila_2:1626655_at:676:51; Interrogation_Position=1538; Antisense; ATGCGTATATTCACTATGCCACCAC
>probe:Drosophila_2:1626655_at:183:261; Interrogation_Position=1560; Antisense; CACGCACCTGTTTTGTTTGCCGAAG
>probe:Drosophila_2:1626655_at:689:107; Interrogation_Position=994; Antisense; AGAACCACGCCATCATGGAGGACCT

Paste this into a BLAST search page for me
GGAGGACCTCAGTCTAGTGGTTCCCTAGTGGTTCCCGTGAGATTGCGCATTGAGATTGCGCATCGCGGAGTACGAGTACGAGCAGCGCATCTCGATGAGTCTCGATGAGTGCTTAGGTCCAGAAAAATGTAAGCGTCTTGTTCTTGGCAAAAACCATTACTCCTTTGCAATCGGTGATATTCTATTTCTGACCAAACCCTGAATTGCTAAATCCACACACTACCAGTAAACTGAATCACGCAAGACTCCGGTGTCCACACCTATATTCGTGTGCAATGCGTATATTCACTATGCCACCACCACGCACCTGTTTTGTTTGCCGAAGAGAACCACGCCATCATGGAGGACCT

Full Affymetrix probeset data:

Annotations for 1626655_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime