FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626659_at:

>probe:Drosophila_2:1626659_at:229:551; Interrogation_Position=444; Antisense; GGAGCTAATGCTCGACTACGGCACG
>probe:Drosophila_2:1626659_at:333:147; Interrogation_Position=458; Antisense; ACTACGGCACGGAGGCATGGAAGTC
>probe:Drosophila_2:1626659_at:181:269; Interrogation_Position=473; Antisense; CATGGAAGTCCTACCTGGAGGTCTT
>probe:Drosophila_2:1626659_at:363:587; Interrogation_Position=488; Antisense; TGGAGGTCTTCACCGCCATGCAGGC
>probe:Drosophila_2:1626659_at:212:13; Interrogation_Position=550; Antisense; ATTCAAGATGTCAACTGGCAGCGCA
>probe:Drosophila_2:1626659_at:385:379; Interrogation_Position=616; Antisense; GAAGCCCATTGGGTGCTGCTGGTCT
>probe:Drosophila_2:1626659_at:450:561; Interrogation_Position=678; Antisense; GGAAAAGATCGTCCATGCCGCCCGT
>probe:Drosophila_2:1626659_at:587:647; Interrogation_Position=702; Antisense; TCAGCAGCTGCGGAAGATTACCCCG
>probe:Drosophila_2:1626659_at:368:337; Interrogation_Position=748; Antisense; GCTCCAACGCCGGAATACACGAATG
>probe:Drosophila_2:1626659_at:706:477; Interrogation_Position=773; Antisense; GTTTCGACCAGAACGATTTGGCCGA
>probe:Drosophila_2:1626659_at:718:111; Interrogation_Position=799; Antisense; AGCAACGGCAGTAGCTCCAGCAATC
>probe:Drosophila_2:1626659_at:677:265; Interrogation_Position=824; Antisense; CAGATCCAAGCCAACCTGGCGATGA
>probe:Drosophila_2:1626659_at:628:385; Interrogation_Position=851; Antisense; GAACAGATGCCGATGGTGACAGCAA
>probe:Drosophila_2:1626659_at:700:293; Interrogation_Position=891; Antisense; CGAGGCACAGGAGGAATCTTCCAAT

Paste this into a BLAST search page for me
GGAGCTAATGCTCGACTACGGCACGACTACGGCACGGAGGCATGGAAGTCCATGGAAGTCCTACCTGGAGGTCTTTGGAGGTCTTCACCGCCATGCAGGCATTCAAGATGTCAACTGGCAGCGCAGAAGCCCATTGGGTGCTGCTGGTCTGGAAAAGATCGTCCATGCCGCCCGTTCAGCAGCTGCGGAAGATTACCCCGGCTCCAACGCCGGAATACACGAATGGTTTCGACCAGAACGATTTGGCCGAAGCAACGGCAGTAGCTCCAGCAATCCAGATCCAAGCCAACCTGGCGATGAGAACAGATGCCGATGGTGACAGCAACGAGGCACAGGAGGAATCTTCCAAT

Full Affymetrix probeset data:

Annotations for 1626659_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720