FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626660_at:

>probe:Drosophila_2:1626660_at:15:387; Interrogation_Position=117; Antisense; GAACAACGAGTTTCCTACGGGCGAG
>probe:Drosophila_2:1626660_at:334:67; Interrogation_Position=13; Antisense; ATGGCAATTTGTCTGGCCGCCCGAG
>probe:Drosophila_2:1626660_at:149:267; Interrogation_Position=164; Antisense; CAGTGGCTCCCTCCGATGCGGAACT
>probe:Drosophila_2:1626660_at:91:289; Interrogation_Position=182; Antisense; CGGAACTCGGCCAGGCTGAAGATCT
>probe:Drosophila_2:1626660_at:341:585; Interrogation_Position=206; Antisense; TGGAGGAACCAGTAGAACCAACAAC
>probe:Drosophila_2:1626660_at:552:107; Interrogation_Position=219; Antisense; AGAACCAACAACAGCCGGCACAACT
>probe:Drosophila_2:1626660_at:187:567; Interrogation_Position=235; Antisense; GGCACAACTGCCTCCAAGAAAATCC
>probe:Drosophila_2:1626660_at:500:29; Interrogation_Position=264; Antisense; ATACAAATACCAGGTGCCCAGTCGG
>probe:Drosophila_2:1626660_at:209:319; Interrogation_Position=279; Antisense; GCCCAGTCGGCGCTTTAAGAGCTAA
>probe:Drosophila_2:1626660_at:74:295; Interrogation_Position=34; Antisense; CGAGCAGATGTCTCCCAGTTGGTGA
>probe:Drosophila_2:1626660_at:76:265; Interrogation_Position=49; Antisense; CAGTTGGTGAGATCTGGCAATGGAT
>probe:Drosophila_2:1626660_at:378:359; Interrogation_Position=65; Antisense; GCAATGGATTTGTTTACGATGTACC
>probe:Drosophila_2:1626660_at:83:479; Interrogation_Position=76; Antisense; GTTTACGATGTACCCAAAGTCACGG
>probe:Drosophila_2:1626660_at:413:255; Interrogation_Position=90; Antisense; CAAAGTCACGGAACTAGAGCTGGAG

Paste this into a BLAST search page for me
GAACAACGAGTTTCCTACGGGCGAGATGGCAATTTGTCTGGCCGCCCGAGCAGTGGCTCCCTCCGATGCGGAACTCGGAACTCGGCCAGGCTGAAGATCTTGGAGGAACCAGTAGAACCAACAACAGAACCAACAACAGCCGGCACAACTGGCACAACTGCCTCCAAGAAAATCCATACAAATACCAGGTGCCCAGTCGGGCCCAGTCGGCGCTTTAAGAGCTAACGAGCAGATGTCTCCCAGTTGGTGACAGTTGGTGAGATCTGGCAATGGATGCAATGGATTTGTTTACGATGTACCGTTTACGATGTACCCAAAGTCACGGCAAAGTCACGGAACTAGAGCTGGAG

Full Affymetrix probeset data:

Annotations for 1626660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720