FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626662_at:

>probe:Drosophila_2:1626662_at:227:425; Interrogation_Position=1458; Antisense; GAGACCATAGATACCACGACCATAA
>probe:Drosophila_2:1626662_at:64:609; Interrogation_Position=1525; Antisense; TGCGGAAGGATTCGCCTAGGCAACT
>probe:Drosophila_2:1626662_at:184:567; Interrogation_Position=1543; Antisense; GGCAACTGGAACAGCCATCTCAGAT
>probe:Drosophila_2:1626662_at:671:97; Interrogation_Position=1564; Antisense; AGATGCCTATGATGGCTCCCAATCA
>probe:Drosophila_2:1626662_at:288:529; Interrogation_Position=1589; Antisense; GGGTAACTTTTGCAATCCTGGCATT
>probe:Drosophila_2:1626662_at:475:533; Interrogation_Position=1626; Antisense; GGTGTCAATGAATCCAAGTCCAAGT
>probe:Drosophila_2:1626662_at:102:629; Interrogation_Position=1644; Antisense; TCCAAGTGCGGCATCCATCAGGATA
>probe:Drosophila_2:1626662_at:384:109; Interrogation_Position=1723; Antisense; AGAATGGCTGCAAGGCCGATGCCTT
>probe:Drosophila_2:1626662_at:363:271; Interrogation_Position=1772; Antisense; CATCGGAATTCGCATGGAGCTGGTC
>probe:Drosophila_2:1626662_at:46:497; Interrogation_Position=1828; Antisense; GTCATCCATAGACACTCCATTTGTG
>probe:Drosophila_2:1626662_at:115:21; Interrogation_Position=1846; Antisense; ATTTGTGGTCCATGCTGCACGAAGA
>probe:Drosophila_2:1626662_at:658:609; Interrogation_Position=1895; Antisense; TGAAACACCGGTCAAGGCCAACTGG
>probe:Drosophila_2:1626662_at:279:195; Interrogation_Position=1914; Antisense; AACTGGTGGCCAACCGGAGTTCTCT
>probe:Drosophila_2:1626662_at:70:93; Interrogation_Position=1931; Antisense; AGTTCTCTCTGTGCCCGGAAGTGAT

Paste this into a BLAST search page for me
GAGACCATAGATACCACGACCATAATGCGGAAGGATTCGCCTAGGCAACTGGCAACTGGAACAGCCATCTCAGATAGATGCCTATGATGGCTCCCAATCAGGGTAACTTTTGCAATCCTGGCATTGGTGTCAATGAATCCAAGTCCAAGTTCCAAGTGCGGCATCCATCAGGATAAGAATGGCTGCAAGGCCGATGCCTTCATCGGAATTCGCATGGAGCTGGTCGTCATCCATAGACACTCCATTTGTGATTTGTGGTCCATGCTGCACGAAGATGAAACACCGGTCAAGGCCAACTGGAACTGGTGGCCAACCGGAGTTCTCTAGTTCTCTCTGTGCCCGGAAGTGAT

Full Affymetrix probeset data:

Annotations for 1626662_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720